ID: 932910703

View in Genome Browser
Species Human (GRCh38)
Location 2:75803302-75803324
Sequence CGAGATTCAGTAACTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932910703_932910706 -1 Left 932910703 2:75803302-75803324 CCTTTTAAAGTTACTGAATCTCG No data
Right 932910706 2:75803324-75803346 GGAAGGATAAAGTAACTTAAAGG No data
932910703_932910708 26 Left 932910703 2:75803302-75803324 CCTTTTAAAGTTACTGAATCTCG No data
Right 932910708 2:75803351-75803373 ACAATCATTTGGAAGACCCTAGG No data
932910703_932910707 15 Left 932910703 2:75803302-75803324 CCTTTTAAAGTTACTGAATCTCG No data
Right 932910707 2:75803340-75803362 TTAAAGGTCACACAATCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932910703 Original CRISPR CGAGATTCAGTAACTTTAAA AGG (reversed) Intergenic
No off target data available for this crispr