ID: 932910706

View in Genome Browser
Species Human (GRCh38)
Location 2:75803324-75803346
Sequence GGAAGGATAAAGTAACTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932910703_932910706 -1 Left 932910703 2:75803302-75803324 CCTTTTAAAGTTACTGAATCTCG No data
Right 932910706 2:75803324-75803346 GGAAGGATAAAGTAACTTAAAGG No data
932910702_932910706 14 Left 932910702 2:75803287-75803309 CCTAATCTAGTTCAGCCTTTTAA No data
Right 932910706 2:75803324-75803346 GGAAGGATAAAGTAACTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932910706 Original CRISPR GGAAGGATAAAGTAACTTAA AGG Intergenic
No off target data available for this crispr