ID: 932910875

View in Genome Browser
Species Human (GRCh38)
Location 2:75805037-75805059
Sequence AAGAGGAAGCAGAAGGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932910867_932910875 11 Left 932910867 2:75805003-75805025 CCTTCACTCCAAGCTTCGAGACC No data
Right 932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG No data
932910870_932910875 -10 Left 932910870 2:75805024-75805046 CCCCTTTACTGATAAGAGGAAGC No data
Right 932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG No data
932910866_932910875 21 Left 932910866 2:75804993-75805015 CCTGGGTGTTCCTTCACTCCAAG No data
Right 932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG No data
932910868_932910875 3 Left 932910868 2:75805011-75805033 CCAAGCTTCGAGACCCCTTTACT No data
Right 932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG No data
932910865_932910875 30 Left 932910865 2:75804984-75805006 CCTAAACTACCTGGGTGTTCCTT No data
Right 932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932910875 Original CRISPR AAGAGGAAGCAGAAGGTTGG TGG Intergenic
No off target data available for this crispr