ID: 932918178

View in Genome Browser
Species Human (GRCh38)
Location 2:75879091-75879113
Sequence CGGCAAACAGCAGTGGTAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932918178_932918185 13 Left 932918178 2:75879091-75879113 CCGTCTACCACTGCTGTTTGCCG No data
Right 932918185 2:75879127-75879149 ACTGCTGAGTTCTATCCCTCCGG No data
932918178_932918186 23 Left 932918178 2:75879091-75879113 CCGTCTACCACTGCTGTTTGCCG No data
Right 932918186 2:75879137-75879159 TCTATCCCTCCGGATCCGTCAGG No data
932918178_932918187 24 Left 932918178 2:75879091-75879113 CCGTCTACCACTGCTGTTTGCCG No data
Right 932918187 2:75879138-75879160 CTATCCCTCCGGATCCGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932918178 Original CRISPR CGGCAAACAGCAGTGGTAGA CGG (reversed) Intergenic
No off target data available for this crispr