ID: 932923324

View in Genome Browser
Species Human (GRCh38)
Location 2:75942083-75942105
Sequence CTCTGTTAGGGCAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932923319_932923324 -10 Left 932923319 2:75942070-75942092 CCTCATGGAGAACCTCTGTTAGG 0: 47
1: 1160
2: 1643
3: 1360
4: 980
Right 932923324 2:75942083-75942105 CTCTGTTAGGGCAATGTGGAAGG No data
932923314_932923324 20 Left 932923314 2:75942040-75942062 CCAGGCATAAGTCTGCTGCAGGG No data
Right 932923324 2:75942083-75942105 CTCTGTTAGGGCAATGTGGAAGG No data
932923318_932923324 -9 Left 932923318 2:75942069-75942091 CCCTCATGGAGAACCTCTGTTAG 0: 46
1: 1151
2: 1534
3: 1216
4: 943
Right 932923324 2:75942083-75942105 CTCTGTTAGGGCAATGTGGAAGG No data
932923312_932923324 29 Left 932923312 2:75942031-75942053 CCTGGATGTCCAGGCATAAGTCT No data
Right 932923324 2:75942083-75942105 CTCTGTTAGGGCAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932923324 Original CRISPR CTCTGTTAGGGCAATGTGGA AGG Intergenic
No off target data available for this crispr