ID: 932947572

View in Genome Browser
Species Human (GRCh38)
Location 2:76254504-76254526
Sequence CTCCTACGCTACCCTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932947572_932947575 13 Left 932947572 2:76254504-76254526 CCCTGCTCAGGGTAGCGTAGGAG No data
Right 932947575 2:76254540-76254562 TTAGGAGCTTCAGATAGCTTAGG No data
932947572_932947574 -5 Left 932947572 2:76254504-76254526 CCCTGCTCAGGGTAGCGTAGGAG No data
Right 932947574 2:76254522-76254544 AGGAGCTTAGATAGAAGCTTAGG No data
932947572_932947576 16 Left 932947572 2:76254504-76254526 CCCTGCTCAGGGTAGCGTAGGAG No data
Right 932947576 2:76254543-76254565 GGAGCTTCAGATAGCTTAGGAGG No data
932947572_932947577 21 Left 932947572 2:76254504-76254526 CCCTGCTCAGGGTAGCGTAGGAG No data
Right 932947577 2:76254548-76254570 TTCAGATAGCTTAGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932947572 Original CRISPR CTCCTACGCTACCCTGAGCA GGG (reversed) Intergenic
No off target data available for this crispr