ID: 932947842

View in Genome Browser
Species Human (GRCh38)
Location 2:76258199-76258221
Sequence GTTGCATGGCACTGTGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932947842 Original CRISPR GTTGCATGGCACTGTGGACT TGG (reversed) Intergenic
901099998 1:6712575-6712597 GTTGCATGGCTGCGTGGGCTGGG + Intergenic
902732539 1:18378756-18378778 GTTGCATGCCACTGAGGTTTGGG - Intergenic
905367619 1:37462542-37462564 GTTCCATGGCACTCCGGCCTGGG + Intergenic
905576239 1:39046920-39046942 GTCACATGGCACTGTGGCCAAGG + Intergenic
907765596 1:57407522-57407544 GTGGCATGTCACTGTGTACCAGG + Intronic
909077929 1:71075445-71075467 TTTGCATGGCAATGTTGAATAGG + Intronic
909727747 1:78855931-78855953 GATGCATGGCTTTGTGGAATAGG - Intergenic
912064708 1:105722700-105722722 GTGTCATGGCACTCTGGCCTGGG + Intergenic
913494638 1:119417295-119417317 TCTCCAAGGCACTGTGGACTTGG - Intronic
913508427 1:119540665-119540687 TCTCCAAGGCACTGTGGACTTGG - Intergenic
913510895 1:119561046-119561068 GTTGCCTGGAGCTGGGGACTGGG + Intergenic
913515118 1:119598452-119598474 GTTGCCTGGAGCTGGGGACTGGG + Intergenic
915700388 1:157786823-157786845 GTACCATGGCACTTTAGACTGGG + Intergenic
917054028 1:170958863-170958885 TTAGCATGGCTTTGTGGACTTGG + Intronic
917391560 1:174542933-174542955 GTTTGATTGCACTGTGGTCTGGG + Intronic
919623039 1:199884288-199884310 GTTTGATTGCACTGTGGTCTGGG + Intergenic
920995373 1:210985622-210985644 GTTTGATTGCACTGTGGTCTGGG + Intronic
922421817 1:225465567-225465589 GTCTCATGGCACTGTGGATCAGG - Intergenic
1062988958 10:1797064-1797086 GTTTCATGTCACTGTGCAATTGG - Intergenic
1063375946 10:5554214-5554236 GGTGCATGGCTCTGTAGACGTGG - Intergenic
1064676942 10:17769893-17769915 GTTGCATGATGCTGTGGTCTGGG + Intronic
1065200024 10:23303970-23303992 GCTTCATTGCCCTGTGGACTTGG + Intronic
1066755466 10:38707643-38707665 ATTTGATGGCACTGTGGTCTGGG - Intergenic
1068131687 10:52902863-52902885 GTGCCATGGCACTCTGGCCTGGG + Intergenic
1072198324 10:93136093-93136115 AGTGCCTGGCACTGTGAACTTGG - Intergenic
1073633416 10:105172354-105172376 GTTGAATGGTAGTGTGTACTTGG + Intronic
1076158224 10:128220124-128220146 GCTGCATGGGATTGTAGACTAGG + Intergenic
1076653643 10:132006910-132006932 TTTGCTTTGCACTGTGGACTTGG + Intergenic
1079469432 11:20764368-20764390 AATCTATGGCACTGTGGACTTGG + Intronic
1079925651 11:26488827-26488849 GTTGCTTGGCACTGCTGGCTCGG + Intronic
1080393937 11:31872895-31872917 GTTGCATGGGACAATGTACTGGG + Intronic
1081767030 11:45618536-45618558 GTAGCATCACACTGGGGACTAGG - Intergenic
1081891512 11:46546333-46546355 TTTGCATGGAACTGTGGGCTGGG - Intronic
1084667722 11:70585437-70585459 ATTGCAGGGCAGTGTGGCCTGGG - Intronic
1085241143 11:75057066-75057088 GATGCATGACTCTGTTGACTTGG + Intergenic
1086333184 11:85774466-85774488 TTTGCAGGGCACTGTGTACCTGG - Intronic
1086393975 11:86395333-86395355 GAGGCCTGGCACTGTGGACTCGG + Exonic
1087036721 11:93763711-93763733 GTTTCATTGCACTGTAGCCTGGG + Intronic
1089332304 11:117698378-117698400 GTTGCATGGCAGTGAAGTCTGGG - Intronic
1090864883 11:130691016-130691038 ATTGCGTGGCACTGAGGTCTGGG + Intronic
1091456246 12:610279-610301 GGTGCTGGGCACTGGGGACTGGG - Intronic
1093955473 12:25212939-25212961 GTGCCATGGCACTGTAGCCTAGG - Intronic
1094104941 12:26801146-26801168 GCTGCATGGCAATGGGGACCTGG - Intronic
1094710688 12:32958969-32958991 GTTTGATTGCACTGTGGTCTGGG - Intergenic
1096547541 12:52350992-52351014 GTTGCATGGTCCTCTGGACTTGG + Intergenic
1096548524 12:52357197-52357219 GGGGCATGGGACTGTGGACTGGG + Intergenic
1097251405 12:57634223-57634245 GTGCCATGGCACTGTAGCCTGGG + Intergenic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1104060827 12:125266879-125266901 GTCCCATGGCACTCTGGGCTGGG + Intronic
1106428805 13:29659352-29659374 GTTGCAGGACCCTGTGGAATGGG + Intergenic
1109695092 13:65944803-65944825 GTTGGGTGGGACTGTGGAATTGG + Intergenic
1110075570 13:71237615-71237637 GTTGCATTGCAATGTGAAATGGG - Intergenic
1112540520 13:100307194-100307216 GTTGGATGCCACTGTCCACTCGG - Exonic
1113406858 13:110049080-110049102 GTTTGATTGCACTGTGGTCTGGG - Intergenic
1115451628 14:33554416-33554438 GATGCATGGCACATTGGACAAGG + Intronic
1117479040 14:56125049-56125071 GTTGGAAGGCACAGTGGAGTTGG + Intronic
1120420357 14:84277415-84277437 GTTATATGATACTGTGGACTTGG - Intergenic
1121722676 14:96121704-96121726 TTAGCACAGCACTGTGGACTGGG - Intergenic
1122310523 14:100791516-100791538 GAAGCAGGGCACTGTGGACATGG + Intergenic
1122388570 14:101365126-101365148 GTTGCCTGGGTCTGTGGCCTCGG - Intergenic
1122892917 14:104741352-104741374 CATGGATGGCACTGTGGCCTTGG - Intronic
1127416606 15:58763748-58763770 GTGCCATTGCACTGTGGCCTGGG + Intergenic
1132987704 16:2776750-2776772 GTTGCATGCCACGGTGCCCTCGG + Intronic
1136727214 16:32369200-32369222 ATTTGATGGCACTGTGGTCTGGG + Intergenic
1140491581 16:75341329-75341351 TTTGAATCCCACTGTGGACTAGG - Intronic
1142013654 16:87731535-87731557 GTAGGAAGTCACTGTGGACTTGG - Intronic
1142080325 16:88145750-88145772 GTTGCCCGGCACTGGGGGCTGGG - Intergenic
1202999219 16_KI270728v1_random:148548-148570 ATTTGATGGCACTGTGGTCTGGG - Intergenic
1203130817 16_KI270728v1_random:1684958-1684980 ATTTGATGGCACTGTGGTCTGGG - Intergenic
1144088944 17:11835989-11836011 TTTGACTGGCACGGTGGACTGGG - Intronic
1148619214 17:49022028-49022050 GTTCCCTGGGACTGGGGACTTGG + Intronic
1151694083 17:75705255-75705277 GTTCCCTGGCAGTGTGGTCTGGG + Intronic
1153115015 18:1644524-1644546 GTTTGATTGCACTGTGGTCTGGG + Intergenic
1156758930 18:40563003-40563025 GTTGCATGTCACTATGGCATGGG - Intergenic
1157986675 18:52446369-52446391 TTTGCTTGGCATTTTGGACTTGG - Intronic
1158765242 18:60443199-60443221 GTTGCATTGCACTCCAGACTGGG - Intergenic
1161572374 19:5037637-5037659 TTCGCTTGGCACTGTGGACTTGG + Intronic
1163282837 19:16327551-16327573 GTTGCTTGGAACTGGGGCCTTGG + Exonic
1164764027 19:30749472-30749494 AGGGCATTGCACTGTGGACTAGG - Intergenic
925748345 2:7064182-7064204 GTTGCATTGCATTGTGGATTAGG + Intronic
927756112 2:25709107-25709129 GTGCCATTGCACTGTGGCCTGGG + Intergenic
932321088 2:70822500-70822522 GCTCCATGGCACTGTCCACTGGG - Intergenic
932947842 2:76258199-76258221 GTTGCATGGCACTGTGGACTTGG - Intergenic
934016578 2:87892101-87892123 TTTGCTTTGCACTGTGGACTCGG + Intergenic
935606358 2:104975517-104975539 GTTCCATGACAGTGTGGACGTGG + Intergenic
936438234 2:112527127-112527149 GTTTGATTGCACTGTGGTCTGGG + Intronic
937149956 2:119679381-119679403 GCTGCATGGTACTGTGTTCTAGG + Exonic
938983879 2:136554094-136554116 GTGGCATGGCATGGTAGACTAGG + Intergenic
939291486 2:140201773-140201795 GTGGGATGGCAATTTGGACTTGG + Intergenic
940080323 2:149793952-149793974 GTTTGATTGCACTGTGGTCTGGG + Intergenic
947012516 2:225582337-225582359 GGGGCATGGCACTGAGGCCTTGG - Exonic
947530304 2:230904953-230904975 GTTGCTGGGCACTGGGCACTGGG - Intergenic
948120240 2:235524072-235524094 GTTCCATGGGACTGTGGAAAGGG + Intronic
948718408 2:239881056-239881078 GTTGCAGGGCTCTGTGAGCTAGG - Intergenic
1174142315 20:48424517-48424539 CTTGGGTGGCACTGTGGACGGGG - Intergenic
1174305382 20:49611095-49611117 GTTGCCTGGCAGTGTGGACGTGG + Intergenic
1178488952 21:33035851-33035873 TTTGCATTGCATTGTGGACGAGG + Intergenic
1178783528 21:35629854-35629876 CTTGCATGGCAATAGGGACTTGG - Intronic
1179172235 21:38981525-38981547 GTTGCTTAGCACTTTTGACTGGG - Intergenic
1179815155 21:43900931-43900953 GCTGCTGGGCACTGTGAACTTGG - Intronic
1180306943 22:11135541-11135563 ATTTGATGGCACTGTGGTCTGGG - Intergenic
1180545463 22:16497724-16497746 ATTTGATGGCACTGTGGTCTGGG - Intergenic
1182029193 22:27144263-27144285 ATTGCAAGGCACTGGGGATTAGG - Intergenic
1182538280 22:31022585-31022607 GTGGCATGGGCCTGTGGTCTCGG - Intergenic
1183070719 22:35394142-35394164 GTTTAACGGCACTGTGGCCTTGG + Exonic
1183428201 22:37750835-37750857 GTGGCATGGCTCAGTGGAGTGGG - Intronic
1184862395 22:47180450-47180472 GTTGCAAGCCACTGTGGGGTGGG - Intergenic
950652351 3:14415234-14415256 GGTACAAGGCACTGTGGAGTAGG - Intronic
951192695 3:19787983-19788005 GTTTGATTGCACTGTGGTCTGGG - Intergenic
951351246 3:21609753-21609775 GTTCCTTGACACTGTGGTCTTGG + Intronic
953510414 3:43532003-43532025 GCTGCTTGGCAATGTGGACGGGG - Intronic
954067891 3:48121534-48121556 GTGCCATTGCACTGTGGCCTGGG - Intergenic
954166280 3:48760790-48760812 GTGGCATTGCACTCTGGCCTGGG + Intronic
956076566 3:65511957-65511979 GTTTGATTGCACTGTGGTCTGGG - Intronic
958162484 3:89834497-89834519 GTTTGATTGCACTGTGGTCTGGG - Intergenic
961661872 3:128473321-128473343 GGAGCCTGGCAGTGTGGACTGGG + Intergenic
964763201 3:160153662-160153684 GGAGCAGGGCACTGTGGAATGGG + Intergenic
967220676 3:187245573-187245595 TTTCCCTGCCACTGTGGACTTGG - Intronic
969088253 4:4672597-4672619 GTGGCACGTCACTGTGTACTTGG - Intergenic
969247579 4:5945546-5945568 GTCGCAGGGCCCTGTGGAGTCGG + Intronic
969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG + Intronic
969538300 4:7770141-7770163 GTCGCAAAGCACAGTGGACTGGG + Intronic
970522930 4:16903646-16903668 GCTGCATGGCAGTGTGCAGTGGG + Intergenic
970796438 4:19919011-19919033 GTTTGATTGCACTGTGGTCTGGG + Intergenic
974983795 4:68994152-68994174 GTGGCAGGGCAGTGTGGTCTTGG + Intergenic
976086173 4:81409336-81409358 CTTGCATGGCCCTGTGAAGTTGG + Intergenic
977457478 4:97279815-97279837 GTTGCAAGACAGTTTGGACTTGG - Intronic
978917464 4:114144558-114144580 GTTAGATGGGACTTTGGACTTGG + Intergenic
979564180 4:122135705-122135727 ATTGCTTGGCATTGTTGACTGGG - Intergenic
980073673 4:128270246-128270268 GGTGCATGGGGCTGTGGAGTGGG - Exonic
985336800 4:188905242-188905264 GTTGCGGGACACTCTGGACTGGG + Intergenic
985357158 4:189133621-189133643 GTTGCATGACACTGAGGTTTGGG - Intergenic
987491611 5:18586866-18586888 CTTGCATGGGACTGAGAACTGGG + Intergenic
988099279 5:26657045-26657067 GTTGCAGGGCACTGAGCAGTGGG + Intergenic
988424682 5:31049779-31049801 GTTGCATTGCACTATGGAGAGGG - Intergenic
988736363 5:34025766-34025788 ATTCCATGGAAATGTGGACTAGG + Intronic
989171041 5:38470367-38470389 CTTGCATGGAACTGTGGAAATGG - Intergenic
990078606 5:51883802-51883824 CTTTCATGACACTGTGGCCTTGG + Intergenic
991772961 5:70056896-70056918 CTTGCATTTCACTGTGGAATGGG + Intronic
991852254 5:70932320-70932342 CTTGCATTTCACTGTGGAATGGG + Intronic
991987011 5:72299195-72299217 ATTGCATGGCACTGAGGTTTGGG - Intronic
993194418 5:84722601-84722623 GTTACATCCCCCTGTGGACTTGG + Intergenic
993465641 5:88243144-88243166 ATTGCATGTCACAGTGGTCTGGG + Intronic
995533041 5:113109885-113109907 GTTGCATGGCAGTGGGGGCCAGG - Intronic
995688873 5:114801059-114801081 TTCACATGGCACAGTGGACTGGG + Intergenic
996896121 5:128485064-128485086 GTTGCATTGCACTCAGGCCTAGG - Intronic
998163014 5:139823973-139823995 GTTGCATGCCCAGGTGGACTTGG - Intronic
998872588 5:146567497-146567519 GTTGTTTGGCACTGAGGACATGG + Intergenic
1000152415 5:158516634-158516656 GGTGTGTGGCACTGTGGACTGGG - Intergenic
1001023057 5:168199964-168199986 GTTCAGGGGCACTGTGGACTGGG - Exonic
1003551329 6:7104613-7104635 GTTGCCTAGAACTGAGGACTAGG - Intergenic
1006378686 6:33685450-33685472 GTTGACTGCCACCGTGGACTTGG - Exonic
1009324179 6:62329589-62329611 GTTGCAGTGCAGTGTGGACAGGG - Intergenic
1016881625 6:148917309-148917331 TATGCATGGCCCTGTGTACTAGG - Intronic
1017068416 6:150550707-150550729 GTGCCATGGCACTCTGGCCTGGG - Intergenic
1017642424 6:156507217-156507239 GTTGCATGGCACTCTGAGGTGGG + Intergenic
1018646027 6:165949254-165949276 ATTGCATCGTACTGTGTACTAGG - Intronic
1018721248 6:166574219-166574241 ATTGCATGACGCTGTGGCCTGGG + Intronic
1022488909 7:30801558-30801580 ATGGCATTCCACTGTGGACTGGG - Intronic
1022716266 7:32901423-32901445 GTTGCATTGCACTCTAGCCTGGG + Intergenic
1024854884 7:53766919-53766941 GTTGCAATGCAATGTTGACTGGG + Intergenic
1025071960 7:55907514-55907536 GTTGCGTAGCAATGTGGTCTGGG + Intronic
1026260412 7:68750240-68750262 GTTCCACTGCACTCTGGACTGGG - Intergenic
1026965296 7:74435479-74435501 GTTTCAAAGCACTGTGGGCTTGG + Intergenic
1028211541 7:88080148-88080170 GTTTGATTGCACTGTGGTCTGGG - Intronic
1030345772 7:108431373-108431395 CTTGCATGGCACTGTGGCAAAGG + Intronic
1033484279 7:141773280-141773302 GTTTGATTGCACTGTGGTCTGGG + Intronic
1038721821 8:30043952-30043974 GTTGGCTGGCACTGTGATCTTGG - Intergenic
1038853469 8:31304122-31304144 GTTGCCAGGGACTGTGGAATGGG - Intergenic
1041275111 8:56149467-56149489 GTTTGATTGCACTGTGGTCTGGG + Intergenic
1044915889 8:97112445-97112467 GTGGCATGGCACAGAGGACATGG + Intronic
1046608168 8:116393532-116393554 ATTGTATTGCACTGTGGTCTGGG - Intergenic
1048909014 8:139116433-139116455 GAAGCATGGAACTGAGGACTTGG + Intergenic
1048954646 8:139525837-139525859 GTTGCTAGGCACTGTGGTCCTGG + Intergenic
1049460278 8:142724117-142724139 CCTGCATGGCTCTGTGGGCTTGG + Intergenic
1051673812 9:19539544-19539566 GTTTGATTGCACTGTGGTCTGGG + Intronic
1054990377 9:71318929-71318951 GTTGCTTGGAGCTGGGGACTGGG - Intronic
1057215327 9:93224706-93224728 TTTGCATAGCACTGGGGACTTGG + Intronic
1059677052 9:116549601-116549623 GTTGCAGGGCCCTCTGGGCTGGG - Intronic
1061525886 9:131161883-131161905 GCTGTATGGTACTGTGGTCTAGG - Intronic
1062100269 9:134724374-134724396 GTTGCCTGGCTGTGTGGCCTGGG - Intronic
1062319456 9:135983298-135983320 GCTTCATGGCCATGTGGACTCGG - Intergenic
1185779852 X:2834790-2834812 ATGGCATAGCACTGTGGACTGGG + Intronic
1188935763 X:36173639-36173661 GTTTGATTGCACTGTGGTCTGGG + Intergenic
1192289067 X:69772546-69772568 ATTGCATGTCGCTGAGGACTGGG + Intronic
1193258732 X:79380208-79380230 TCTGCAAGGCACTGTGGAATTGG - Intergenic
1196975792 X:121156192-121156214 TTTACTTTGCACTGTGGACTTGG + Intergenic
1199127908 X:144146439-144146461 TTTGCTTTGCACTGTGGACTCGG - Intergenic
1201186321 Y:11406955-11406977 GTTTGATGGCACTGTGGTCTGGG - Intergenic
1201848454 Y:18450346-18450368 ATTTCATTGCACTGTGGTCTGGG + Intergenic
1201866566 Y:18661879-18661901 GTTTCAAGGCACTGTGGAAAAGG + Intergenic
1201884862 Y:18870029-18870051 ATTTCATTGCACTGTGGTCTGGG - Intergenic