ID: 932960351

View in Genome Browser
Species Human (GRCh38)
Location 2:76406295-76406317
Sequence TGCCCAATGCTGGCAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932960351_932960357 10 Left 932960351 2:76406295-76406317 CCACCCTCTGCCAGCATTGGGCA No data
Right 932960357 2:76406328-76406350 TGTCAGCATTCCCATGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932960351 Original CRISPR TGCCCAATGCTGGCAGAGGG TGG (reversed) Intergenic
No off target data available for this crispr