ID: 932962312

View in Genome Browser
Species Human (GRCh38)
Location 2:76428031-76428053
Sequence TACCCCAGGATCCCCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932962312_932962317 7 Left 932962312 2:76428031-76428053 CCTCTTTGGGGGATCCTGGGGTA No data
Right 932962317 2:76428061-76428083 TGCTCTCAGATCACTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932962312 Original CRISPR TACCCCAGGATCCCCCAAAG AGG (reversed) Intergenic
No off target data available for this crispr