ID: 932967416

View in Genome Browser
Species Human (GRCh38)
Location 2:76492826-76492848
Sequence TTTTGTTACCAAAAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932967414_932967416 -6 Left 932967414 2:76492809-76492831 CCAGCTAAAATTGGGGATTTTGT No data
Right 932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG No data
932967410_932967416 2 Left 932967410 2:76492801-76492823 CCATATGCCCAGCTAAAATTGGG No data
Right 932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG No data
932967407_932967416 17 Left 932967407 2:76492786-76492808 CCTTTACCTGGGAAGCCATATGC No data
Right 932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG No data
932967408_932967416 11 Left 932967408 2:76492792-76492814 CCTGGGAAGCCATATGCCCAGCT No data
Right 932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG No data
932967413_932967416 -5 Left 932967413 2:76492808-76492830 CCCAGCTAAAATTGGGGATTTTG No data
Right 932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932967416 Original CRISPR TTTTGTTACCAAAAGGAAGT AGG Intergenic
No off target data available for this crispr