ID: 932968433

View in Genome Browser
Species Human (GRCh38)
Location 2:76506951-76506973
Sequence AGGGAAAATGGATGTAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932968433_932968438 -2 Left 932968433 2:76506951-76506973 CCCACTTTACATCCATTTTCCCT No data
Right 932968438 2:76506972-76506994 CTTCCCATCTGCCTGCCCTGTGG No data
932968433_932968444 26 Left 932968433 2:76506951-76506973 CCCACTTTACATCCATTTTCCCT No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932968433 Original CRISPR AGGGAAAATGGATGTAAAGT GGG (reversed) Intergenic
No off target data available for this crispr