ID: 932968435

View in Genome Browser
Species Human (GRCh38)
Location 2:76506963-76506985
Sequence AGGCAGATGGGAAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932968435_932968444 14 Left 932968435 2:76506963-76506985 CCATTTTCCCTTCCCATCTGCCT No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932968435 Original CRISPR AGGCAGATGGGAAGGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr