ID: 932968436

View in Genome Browser
Species Human (GRCh38)
Location 2:76506970-76506992
Sequence ACAGGGCAGGCAGATGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932968436_932968444 7 Left 932968436 2:76506970-76506992 CCCTTCCCATCTGCCTGCCCTGT No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932968436 Original CRISPR ACAGGGCAGGCAGATGGGAA GGG (reversed) Intergenic
No off target data available for this crispr