ID: 932968444

View in Genome Browser
Species Human (GRCh38)
Location 2:76507000-76507022
Sequence AAGCTCCAGCATAAAACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932968435_932968444 14 Left 932968435 2:76506963-76506985 CCATTTTCCCTTCCCATCTGCCT No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data
932968433_932968444 26 Left 932968433 2:76506951-76506973 CCCACTTTACATCCATTTTCCCT No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data
932968440_932968444 1 Left 932968440 2:76506976-76506998 CCATCTGCCTGCCCTGTGGATAT No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data
932968434_932968444 25 Left 932968434 2:76506952-76506974 CCACTTTACATCCATTTTCCCTT No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data
932968436_932968444 7 Left 932968436 2:76506970-76506992 CCCTTCCCATCTGCCTGCCCTGT No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data
932968439_932968444 2 Left 932968439 2:76506975-76506997 CCCATCTGCCTGCCCTGTGGATA No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data
932968442_932968444 -10 Left 932968442 2:76506987-76507009 CCCTGTGGATATCAAGCTCCAGC No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data
932968437_932968444 6 Left 932968437 2:76506971-76506993 CCTTCCCATCTGCCTGCCCTGTG No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data
932968441_932968444 -6 Left 932968441 2:76506983-76507005 CCTGCCCTGTGGATATCAAGCTC No data
Right 932968444 2:76507000-76507022 AAGCTCCAGCATAAAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932968444 Original CRISPR AAGCTCCAGCATAAAACCTG AGG Intergenic
No off target data available for this crispr