ID: 932971513

View in Genome Browser
Species Human (GRCh38)
Location 2:76548926-76548948
Sequence AAATGTCCACAGTTGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932971510_932971513 18 Left 932971510 2:76548885-76548907 CCTCACTAATACTACCTCTCAGC No data
Right 932971513 2:76548926-76548948 AAATGTCCACAGTTGGAGACAGG No data
932971511_932971513 4 Left 932971511 2:76548899-76548921 CCTCTCAGCTCACTGTAAATACT No data
Right 932971513 2:76548926-76548948 AAATGTCCACAGTTGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932971513 Original CRISPR AAATGTCCACAGTTGGAGAC AGG Intergenic
No off target data available for this crispr