ID: 932972812

View in Genome Browser
Species Human (GRCh38)
Location 2:76566672-76566694
Sequence CAGAGCCATCACAATAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932972812_932972813 20 Left 932972812 2:76566672-76566694 CCATCTTTATTGTGATGGCTCTG No data
Right 932972813 2:76566715-76566737 CTAGCCTTACTCTGAATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932972812 Original CRISPR CAGAGCCATCACAATAAAGA TGG (reversed) Intergenic
No off target data available for this crispr