ID: 932975797

View in Genome Browser
Species Human (GRCh38)
Location 2:76598101-76598123
Sequence ACTCAGCAGTACCTGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932975797_932975802 23 Left 932975797 2:76598101-76598123 CCTGGCTACAGGTACTGCTGAGT No data
Right 932975802 2:76598147-76598169 CCAACAATGAGCCTTCGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932975797 Original CRISPR ACTCAGCAGTACCTGTAGCC AGG (reversed) Intergenic
No off target data available for this crispr