ID: 932975934

View in Genome Browser
Species Human (GRCh38)
Location 2:76599691-76599713
Sequence GAGGGGTATGTCTACTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932975934_932975936 -10 Left 932975934 2:76599691-76599713 CCTTTCCAGTAGACATACCCCTC No data
Right 932975936 2:76599704-76599726 CATACCCCTCTTGTATTTTGTGG No data
932975934_932975941 16 Left 932975934 2:76599691-76599713 CCTTTCCAGTAGACATACCCCTC No data
Right 932975941 2:76599730-76599752 AGCCTGGCCTCTGCTACTCCTGG No data
932975934_932975940 0 Left 932975934 2:76599691-76599713 CCTTTCCAGTAGACATACCCCTC No data
Right 932975940 2:76599714-76599736 TTGTATTTTGTGGTTAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932975934 Original CRISPR GAGGGGTATGTCTACTGGAA AGG (reversed) Intergenic
No off target data available for this crispr