ID: 932980812

View in Genome Browser
Species Human (GRCh38)
Location 2:76663570-76663592
Sequence CTATGAGTCTTTTAATGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932980812_932980815 21 Left 932980812 2:76663570-76663592 CCAAAACATTAAAAGACTCATAG No data
Right 932980815 2:76663614-76663636 TATTCCACCCACATGGGTATAGG No data
932980812_932980813 14 Left 932980812 2:76663570-76663592 CCAAAACATTAAAAGACTCATAG No data
Right 932980813 2:76663607-76663629 AAAAAAATATTCCACCCACATGG No data
932980812_932980814 15 Left 932980812 2:76663570-76663592 CCAAAACATTAAAAGACTCATAG No data
Right 932980814 2:76663608-76663630 AAAAAATATTCCACCCACATGGG No data
932980812_932980816 22 Left 932980812 2:76663570-76663592 CCAAAACATTAAAAGACTCATAG No data
Right 932980816 2:76663615-76663637 ATTCCACCCACATGGGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932980812 Original CRISPR CTATGAGTCTTTTAATGTTT TGG (reversed) Intergenic
No off target data available for this crispr