ID: 932980815

View in Genome Browser
Species Human (GRCh38)
Location 2:76663614-76663636
Sequence TATTCCACCCACATGGGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932980812_932980815 21 Left 932980812 2:76663570-76663592 CCAAAACATTAAAAGACTCATAG No data
Right 932980815 2:76663614-76663636 TATTCCACCCACATGGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932980815 Original CRISPR TATTCCACCCACATGGGTAT AGG Intergenic
No off target data available for this crispr