ID: 932986414

View in Genome Browser
Species Human (GRCh38)
Location 2:76731161-76731183
Sequence ACTTCAGGCCAAACTTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932986402_932986414 28 Left 932986402 2:76731110-76731132 CCTACTTGAATAATTCAGTTTCC No data
Right 932986414 2:76731161-76731183 ACTTCAGGCCAAACTTGTGGAGG No data
932986406_932986414 0 Left 932986406 2:76731138-76731160 CCCCTACAACTCTCTCATCCCCA No data
Right 932986414 2:76731161-76731183 ACTTCAGGCCAAACTTGTGGAGG No data
932986408_932986414 -2 Left 932986408 2:76731140-76731162 CCTACAACTCTCTCATCCCCAAC No data
Right 932986414 2:76731161-76731183 ACTTCAGGCCAAACTTGTGGAGG No data
932986407_932986414 -1 Left 932986407 2:76731139-76731161 CCCTACAACTCTCTCATCCCCAA No data
Right 932986414 2:76731161-76731183 ACTTCAGGCCAAACTTGTGGAGG No data
932986403_932986414 7 Left 932986403 2:76731131-76731153 CCCCTCTCCCCTACAACTCTCTC No data
Right 932986414 2:76731161-76731183 ACTTCAGGCCAAACTTGTGGAGG No data
932986405_932986414 5 Left 932986405 2:76731133-76731155 CCTCTCCCCTACAACTCTCTCAT No data
Right 932986414 2:76731161-76731183 ACTTCAGGCCAAACTTGTGGAGG No data
932986404_932986414 6 Left 932986404 2:76731132-76731154 CCCTCTCCCCTACAACTCTCTCA No data
Right 932986414 2:76731161-76731183 ACTTCAGGCCAAACTTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932986414 Original CRISPR ACTTCAGGCCAAACTTGTGG AGG Intergenic
No off target data available for this crispr