ID: 932986587

View in Genome Browser
Species Human (GRCh38)
Location 2:76733331-76733353
Sequence GTGGCATAGCAAGTAAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932986587_932986593 29 Left 932986587 2:76733331-76733353 CCACTGCTTACTTGCTATGCCAC No data
Right 932986593 2:76733383-76733405 CCTATAGTTCAGTCAAATTCTGG No data
932986587_932986590 3 Left 932986587 2:76733331-76733353 CCACTGCTTACTTGCTATGCCAC No data
Right 932986590 2:76733357-76733379 TTTTCTAACACCAGATCTCTGGG No data
932986587_932986589 2 Left 932986587 2:76733331-76733353 CCACTGCTTACTTGCTATGCCAC No data
Right 932986589 2:76733356-76733378 TTTTTCTAACACCAGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932986587 Original CRISPR GTGGCATAGCAAGTAAGCAG TGG (reversed) Intergenic
No off target data available for this crispr