ID: 932993133

View in Genome Browser
Species Human (GRCh38)
Location 2:76812794-76812816
Sequence AAGAATAAGGAGGAGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3063
Summary {0: 1, 1: 5, 2: 81, 3: 449, 4: 2527}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932993133_932993141 -8 Left 932993133 2:76812794-76812816 CCCCCCTCCTCCTCCTTATTCTT 0: 1
1: 5
2: 81
3: 449
4: 2527
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932993133 Original CRISPR AAGAATAAGGAGGAGGAGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr