ID: 932993141

View in Genome Browser
Species Human (GRCh38)
Location 2:76812809-76812831
Sequence TTATTCTTCCTCTTGCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 371}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932993120_932993141 21 Left 932993120 2:76812765-76812787 CCTCTCCCTCCCCCTCCTCCTCT 0: 5
1: 69
2: 735
3: 5567
4: 16204
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993129_932993141 -2 Left 932993129 2:76812788-76812810 CCCTCCCCCCCCTCCTCCTCCTT 0: 1
1: 16
2: 245
3: 1703
4: 8762
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993125_932993141 10 Left 932993125 2:76812776-76812798 CCCTCCTCCTCTCCCTCCCCCCC 0: 1
1: 21
2: 368
3: 4252
4: 22616
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993128_932993141 3 Left 932993128 2:76812783-76812805 CCTCTCCCTCCCCCCCCTCCTCC 0: 1
1: 21
2: 451
3: 3588
4: 17173
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993126_932993141 9 Left 932993126 2:76812777-76812799 CCTCCTCCTCTCCCTCCCCCCCC 0: 1
1: 33
2: 424
3: 3364
4: 18847
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993135_932993141 -10 Left 932993135 2:76812796-76812818 CCCCTCCTCCTCCTTATTCTTCC 0: 1
1: 4
2: 56
3: 381
4: 2053
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993132_932993141 -7 Left 932993132 2:76812793-76812815 CCCCCCCTCCTCCTCCTTATTCT 0: 1
1: 4
2: 94
3: 472
4: 2722
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993134_932993141 -9 Left 932993134 2:76812795-76812817 CCCCCTCCTCCTCCTTATTCTTC 0: 4
1: 379
2: 1320
3: 3671
4: 11884
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993127_932993141 6 Left 932993127 2:76812780-76812802 CCTCCTCTCCCTCCCCCCCCTCC 0: 1
1: 27
2: 445
3: 3234
4: 18100
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993124_932993141 11 Left 932993124 2:76812775-76812797 CCCCTCCTCCTCTCCCTCCCCCC 0: 1
1: 22
2: 332
3: 2329
4: 10382
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993122_932993141 15 Left 932993122 2:76812771-76812793 CCTCCCCCTCCTCCTCTCCCTCC 0: 9
1: 144
2: 1295
3: 6682
4: 21138
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993123_932993141 12 Left 932993123 2:76812774-76812796 CCCCCTCCTCCTCTCCCTCCCCC 0: 4
1: 138
2: 1414
3: 6750
4: 19509
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993131_932993141 -6 Left 932993131 2:76812792-76812814 CCCCCCCCTCCTCCTCCTTATTC 0: 1
1: 16
2: 456
3: 2210
4: 9381
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993121_932993141 16 Left 932993121 2:76812770-76812792 CCCTCCCCCTCCTCCTCTCCCTC 0: 10
1: 180
2: 877
3: 4908
4: 11900
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993118_932993141 27 Left 932993118 2:76812759-76812781 CCTCCTCCTCTCCCTCCCCCTCC 0: 6
1: 140
2: 1482
3: 6798
4: 21595
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993133_932993141 -8 Left 932993133 2:76812794-76812816 CCCCCCTCCTCCTCCTTATTCTT 0: 1
1: 5
2: 81
3: 449
4: 2527
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993130_932993141 -3 Left 932993130 2:76812789-76812811 CCTCCCCCCCCTCCTCCTCCTTA 0: 1
1: 0
2: 77
3: 1300
4: 8880
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371
932993119_932993141 24 Left 932993119 2:76812762-76812784 CCTCCTCTCCCTCCCCCTCCTCC 0: 6
1: 126
2: 1376
3: 6635
4: 18590
Right 932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG 0: 1
1: 0
2: 3
3: 26
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932993141 Original CRISPR TTATTCTTCCTCTTGCATTA AGG Intronic
904766746 1:32854779-32854801 ATACTCTTCCTCTTGCTTCAGGG + Intronic
908233552 1:62129316-62129338 GTATTTTTCCTCTTCCTTTAAGG - Intronic
908338202 1:63148842-63148864 TTTTTATTCCTATTGCATTGAGG - Intergenic
908649016 1:66311831-66311853 TTTCTCTTCCACTGGCATTAGGG - Intronic
909507439 1:76409486-76409508 TTGTTCTTCCTCCTGCATTTTGG - Intronic
910696580 1:90024794-90024816 TTATTTCTTCTCCTGCATTAGGG + Intronic
912634648 1:111280502-111280524 TTATTCTCTCTGTTGCTTTAAGG + Intergenic
913334305 1:117694815-117694837 TTATTCTTCCTCTTGAAAATGGG - Intergenic
914859729 1:151375921-151375943 TTTTTCTTCATCTTACATTCAGG + Intergenic
914886763 1:151591624-151591646 TAATTCTTCTTCTTCCATTGTGG + Intergenic
915246025 1:154556953-154556975 TTATTTTTCCTCCAGCATTGAGG - Intronic
915997480 1:160578147-160578169 TTATTATTTTTCTTGCATAATGG + Intronic
918013730 1:180612343-180612365 TTATTATTCCTGTTTTATTAAGG + Intergenic
918037613 1:180890704-180890726 TTATTTTTCCCTTTGCATTGTGG - Intergenic
918599553 1:186339954-186339976 TTTTTTTTCCTCTTGTATTGTGG - Intronic
918669856 1:187201363-187201385 TTATTCCTGCTATTGCAATAGGG - Intergenic
918895768 1:190342599-190342621 TTTTTCTTCCTCTCTCATGAGGG + Intronic
918993036 1:191723049-191723071 TTAGACTTTCTCTCGCATTAAGG + Intergenic
919228161 1:194735963-194735985 TTATTTTTCTTCTTGAAATATGG - Intergenic
919941996 1:202294396-202294418 TTATTATTCTTCATGAATTATGG + Intronic
920887365 1:209942746-209942768 TTTTTCTTTCTCTTCCATAAGGG + Intronic
921156858 1:212445714-212445736 ATATCTTTTCTCTTGCATTAGGG + Intronic
921948978 1:220909378-220909400 TTTTTCTTCCTCTTCCAAGAAGG - Intergenic
922359932 1:224812019-224812041 TTTTTGTTCCTCTTTCATCAAGG - Intergenic
923234915 1:232023055-232023077 ATTTTCTTCCTTTTTCATTATGG + Intronic
924645711 1:245875643-245875665 ATATTCTTCCTCTTGCCCAAGGG + Intronic
924727239 1:246682251-246682273 TTTTTTTTCCTATTGCAATAAGG + Intergenic
1063480186 10:6368726-6368748 ACATTCTTCCTCTTGCTTTCAGG + Intergenic
1064498396 10:15940186-15940208 TTTTTTTTCCTTTTGCATTTGGG + Intergenic
1065692476 10:28349310-28349332 TTATTTTTCACCTTGAATTATGG - Intergenic
1066449678 10:35517300-35517322 TTATTGTACCACTAGCATTATGG + Intronic
1066534255 10:36373357-36373379 TTTTTCTCTCTCTTGCTTTATGG - Intergenic
1068520867 10:58076115-58076137 TTATTCTTTCTCTTGCAAAATGG - Intergenic
1068822089 10:61389066-61389088 GTATTCTTCCACATGCATAAAGG - Intergenic
1068905779 10:62320210-62320232 TTTTTCTCTCTCTTACATTACGG + Intergenic
1069083890 10:64117222-64117244 GTATTCTTCCTCTTGCTTTCGGG + Intergenic
1069474773 10:68722486-68722508 TTTTTTTTCCTTTTGCATCATGG + Exonic
1069578563 10:69548230-69548252 TGATTCTTTCCATTGCATTATGG + Intergenic
1071026948 10:81126286-81126308 CTATTGTTCCTCAGGCATTATGG - Intergenic
1073125941 10:101149357-101149379 TTATTTTTTCTCTTGCATCTAGG + Intergenic
1073271322 10:102266624-102266646 TTATTCCTGCTCTTTCCTTAAGG + Intronic
1073627128 10:105110743-105110765 TTATTTTTCTTATTGCTTTAGGG + Intronic
1073921509 10:108465488-108465510 TTATTTTTCTTCTTGCAATAGGG + Intergenic
1075225732 10:120627511-120627533 CTATTCTTCTTCTTAGATTATGG + Intergenic
1076538412 10:131197907-131197929 TTATTTTTGCTCTTACATTTTGG + Intronic
1077681054 11:4240265-4240287 TTCTTTTTCCTCTTGCAGTGTGG - Intergenic
1077863668 11:6205392-6205414 CTATCCATCCTCCTGCATTAGGG - Intergenic
1079179989 11:18183620-18183642 TTATTCCTCCTATTTAATTAAGG + Intronic
1079509951 11:21199175-21199197 TTATTCTTCCTCTTCATTTATGG + Intronic
1079931670 11:26570824-26570846 TTATTGTTGCTCTTGAATTTAGG - Intronic
1081535847 11:43995742-43995764 TTATTCTCCCTCTTGCTCTCTGG - Intergenic
1084367877 11:68715041-68715063 TTAATTCTCCTCTTGAATTATGG - Intronic
1087166047 11:95003713-95003735 TTAGTCTTGTTCTTGCATTTTGG + Intergenic
1087465522 11:98499767-98499789 ATATTCCTCCTCTGGCCTTATGG - Intergenic
1088165960 11:106937601-106937623 TTATTCTTTCTCTTTAATTTAGG - Intronic
1088928585 11:114326724-114326746 TTATTATTACTCCTGCTTTATGG + Intergenic
1089439178 11:118500702-118500724 TTTTTCTTTCTCTTGCTTTTAGG + Intronic
1090124717 11:124074415-124074437 TAATTCTTCCTTTTGCTTTTGGG - Intergenic
1090721528 11:129479301-129479323 TTAGTCTTCCTCTGGCCTTACGG + Intergenic
1091020410 11:132094678-132094700 CTTTTCCTCCTCTTTCATTATGG + Intronic
1091048248 11:132344673-132344695 TTATTCTTCCTCCTTTTTTAGGG - Intergenic
1092043950 12:5412211-5412233 TTATTTTACCTCTTACATTTAGG + Intergenic
1092863433 12:12739763-12739785 TTATGTTTCATCTTTCATTAAGG + Intronic
1093941726 12:25062455-25062477 TGAATCTACCTCTTGGATTAAGG + Intronic
1094317201 12:29147898-29147920 TTTTTCTGTCTCTTGCATTCAGG + Intergenic
1095480893 12:42634452-42634474 TTATTTTTCCTTTGGCTTTATGG + Intergenic
1095670285 12:44851273-44851295 TCATTATTCCTCTTGATTTATGG - Intronic
1098011614 12:66059212-66059234 TTTTTCTTCCTCTTCCATCTGGG + Intergenic
1098187551 12:67913669-67913691 TTTTTCTTTCCCTTGAATTAAGG + Intergenic
1098955708 12:76687577-76687599 TTTTTCTTCCTCCTGCATATTGG - Intergenic
1098978280 12:76927689-76927711 TTATTCTATCTCTTTCTTTATGG - Intergenic
1098980604 12:76951811-76951833 TTATTCTGCCTGTTGTGTTAAGG - Intergenic
1099405572 12:82257483-82257505 ATATTCTTCCTCATACATTTTGG + Intronic
1099787899 12:87289942-87289964 TTATTCTTTCTCATGAACTATGG - Intergenic
1100219269 12:92486330-92486352 TTTTTTTTTCCCTTGCATTAAGG - Intergenic
1100359043 12:93859519-93859541 TTATTCATGCCCTTGCAATAGGG + Intronic
1100944214 12:99761700-99761722 TATTTATTCCTCTTGCATGATGG - Intronic
1101256435 12:102982062-102982084 TTCTTCTTCCACTTTCCTTAGGG + Intergenic
1102141603 12:110619707-110619729 TTATTTTTCCTATTGCACTTTGG - Intronic
1103118740 12:118362246-118362268 CAATTCTTCGTCTTTCATTATGG - Intronic
1103198097 12:119063591-119063613 TTACTCTTCCCCTTGAATTTAGG - Intronic
1107160874 13:37226042-37226064 TGATTCTGCTTCTTGCATCATGG + Intergenic
1108110862 13:47070882-47070904 CTATTCTTCTGCTTGCTTTAGGG + Intergenic
1108111263 13:47075761-47075783 CTATTCTTCTGCTTGCTTTAGGG - Intergenic
1109113075 13:58347863-58347885 TTTTCCTTCCTTTTGCATTCTGG - Intergenic
1109236666 13:59829958-59829980 TTATTCATCCACTGGCATTTAGG - Intronic
1109489159 13:63072555-63072577 TTGTTCGTCTTCTTGAATTAGGG + Intergenic
1109518333 13:63473960-63473982 TCACTCTTCCTCTGCCATTATGG - Intergenic
1109538438 13:63743019-63743041 ATATTTTTCCTCATACATTAGGG - Intergenic
1109695976 13:65958225-65958247 TTATTCTGCCTCTAGCTTTAAGG + Intergenic
1109792090 13:67262317-67262339 TTATTCTTCTTCTTGTATTCAGG + Intergenic
1110124273 13:71922701-71922723 GTATTATTCCTCTACCATTATGG - Intergenic
1110339082 13:74367749-74367771 GTATTTTTCCTCTTGGATCATGG - Intergenic
1110690754 13:78427990-78428012 TTATTATTTTTCTTCCATTAGGG + Intergenic
1110725274 13:78816088-78816110 TGATTCTACCTCTTGCACTTTGG + Intergenic
1111487076 13:88917800-88917822 TGTTTCTTCATCTTGCACTAAGG + Intergenic
1111963145 13:94833587-94833609 TTATGTTTCCTCTTGCATATTGG - Intergenic
1113044224 13:106137361-106137383 TTATTGGTCCTCTTCAATTAGGG + Intergenic
1113240729 13:108334302-108334324 TTATTTTTACTTTTGGATTATGG - Intergenic
1114333837 14:21666061-21666083 TTACTTTTGCTCTTTCATTAAGG - Intergenic
1115629288 14:35227586-35227608 TTCTTCTTCCTCTTCCATCCTGG + Intronic
1116704326 14:48277448-48277470 TTATTCTGCCTCCTACATAAAGG + Intergenic
1117592471 14:57286019-57286041 TTTTTTTTCCGTTTGCATTAGGG - Intronic
1117642917 14:57819452-57819474 TTGCTCTTCCTTATGCATTATGG - Intronic
1117894225 14:60463606-60463628 TTATTTTTCTTCTTTCATTGAGG - Intronic
1118014962 14:61651039-61651061 TTATTCTTGGTCCTGCAATATGG + Intronic
1118183895 14:63521092-63521114 GTATTCATACTCTTGAATTATGG - Intronic
1118548562 14:66922644-66922666 TTTTTCTTTCTCTTGCATACAGG + Exonic
1119402286 14:74371401-74371423 TTATTTTTCATCTTCCATTGTGG + Intergenic
1119576551 14:75728498-75728520 TTATTCTTCATCTTGGAGAATGG - Intronic
1120345369 14:83282261-83282283 TTTTTCTTCTTCTTGAAGTAAGG - Intergenic
1120432432 14:84436155-84436177 TTCTTTTTCCTCTTGCCTTAGGG - Intergenic
1120591137 14:86374276-86374298 TTATTCTTCCTATTTCATATGGG - Intergenic
1120648808 14:87106048-87106070 TTCTTCTTCCTTTTGCATTCTGG - Intergenic
1120876172 14:89378159-89378181 CTGTTCTTCCTTTTGGATTAGGG - Intronic
1121598373 14:95183933-95183955 TTAAACTTCCTCTTGCAAAAAGG + Exonic
1121991789 14:98565052-98565074 TTAATCTTCCCCTAGCATTCTGG + Intergenic
1126743758 15:51804313-51804335 TTATTTTTCATCTAACATTAAGG - Intronic
1128579776 15:68801199-68801221 TTCTTCTTCTTCTTCCTTTAAGG - Intronic
1128868609 15:71135651-71135673 TTTTTCTGCCTCTTGCTTTTGGG + Intronic
1130634113 15:85600024-85600046 TGATCCTTCCTCTTTTATTAAGG + Intronic
1131416535 15:92264484-92264506 TTTTTCTTCCTCTTTCTTTCCGG + Intergenic
1133155876 16:3875504-3875526 GTATTCTTCCTCCTGGGTTAGGG - Intronic
1133568188 16:7015064-7015086 TTTATCTTTTTCTTGCATTATGG + Intronic
1133659323 16:7900815-7900837 TTACACTTCCTCTTGTGTTATGG - Intergenic
1136013435 16:27379576-27379598 TGAATCTGCCTCATGCATTAGGG - Intergenic
1136105850 16:28030001-28030023 TCATTCTTCCTCTTCCTTCAGGG - Intronic
1137816825 16:51406035-51406057 CAATTCTTCCTCTTCCAATATGG + Intergenic
1138835172 16:60425844-60425866 TGATTCTTCCTTTTCCATCATGG - Intergenic
1140379741 16:74475796-74475818 TTCTTCTTCTTCTTCCATTCTGG - Intronic
1140947678 16:79785154-79785176 TTCTTCTTCTTCTTGGATAATGG - Intergenic
1144253720 17:13444680-13444702 TTACTATTCCTCTTGCAATATGG - Intergenic
1146097874 17:29949986-29950008 CAATTCCTCCTCCTGCATTAAGG - Intronic
1147532930 17:41297343-41297365 ATATCCTTCCTCTAGCATGATGG + Intergenic
1147882791 17:43664981-43665003 TTACTCTGCCTTTTGCATAAAGG - Intergenic
1148293837 17:46481840-46481862 TTATCATTCCTCTTAAATTAAGG - Intergenic
1148316020 17:46699543-46699565 TTATCATTCCTCTTAAATTAAGG - Intronic
1148653652 17:49267578-49267600 TCATCCTTCCTCTTGCATATTGG - Intergenic
1149584089 17:57773414-57773436 TTTTTCTTTCTCTTGCTTTTTGG - Intergenic
1149765649 17:59275204-59275226 TTATTTTTCCTCTTTAACTAAGG - Intronic
1153445488 18:5167973-5167995 TCATTCTACCACTTGCATTTAGG - Intronic
1153870313 18:9313011-9313033 TTTTTCTTCTTATTGCCTTATGG - Intergenic
1153903916 18:9643606-9643628 TTTTTCTTCCTTATGCATTTAGG + Intergenic
1154067819 18:11125631-11125653 TTTCTTTTCCTCTTTCATTATGG - Intronic
1154298410 18:13171604-13171626 TTATTATTTCTTTTGTATTATGG - Intergenic
1155283899 18:24269342-24269364 TTATTCTTTCCCTTCCATTCCGG + Intronic
1155636635 18:27963893-27963915 TTATTCTTCCTTTTCCCTAAAGG + Intronic
1156394757 18:36689341-36689363 TTTTTCTGAGTCTTGCATTAAGG - Intronic
1157374532 18:47150675-47150697 TTATTTTTCCTCGTGCATCCCGG - Intronic
1158326135 18:56315542-56315564 TTATTCTTCCTTTTCCATGCAGG - Intergenic
1159320160 18:66838144-66838166 TCATTTTTCTTCTTGAATTAAGG - Intergenic
1164878821 19:31713794-31713816 TCATTCCTCCTCTTGAATTTGGG + Intergenic
1165206386 19:34191863-34191885 TTATCCTTCCTTTTGGATAAAGG + Intronic
1166881721 19:45934177-45934199 TTGTTCTCCCTCTTGGAATATGG - Exonic
925333690 2:3077677-3077699 TTCCTCTTCCTCTTGCTTCATGG - Intergenic
925695147 2:6568532-6568554 TTATTCAGCCTATTGCAATAGGG - Intergenic
926027949 2:9561101-9561123 TTATTTTTCCTGATGCATTTGGG - Intergenic
928710514 2:34000284-34000306 TTAGTCTTCCCTTGGCATTATGG + Intergenic
928815945 2:35294463-35294485 TGATTCTCATTCTTGCATTAAGG + Intergenic
930251224 2:49035806-49035828 TTCATCTTCCTCATGCTTTAAGG - Intronic
930560607 2:52955769-52955791 TCTTTCTTCTTCTTGCATTTAGG - Intergenic
930642927 2:53872800-53872822 TTATTATACCGCTTGCATTTAGG - Intronic
932041166 2:68301522-68301544 CTTTTCTTCCTCTTGCCTTAAGG - Intronic
932285767 2:70530433-70530455 TTATTCTTCTTCTTCCAATGTGG - Intronic
932884139 2:75532671-75532693 CTCTTCTTCCTCTTTCATTCTGG - Intronic
932993141 2:76812809-76812831 TTATTCTTCCTCTTGCATTAAGG + Intronic
933412369 2:81942086-81942108 TTTTTCCTCCTCTTGAATTTGGG + Intergenic
935429854 2:102964082-102964104 TTATCCTTCCTTCTGCATTTGGG + Intergenic
935835591 2:107049523-107049545 TATTTCTTCTTCTTGCATAAAGG + Intergenic
937496743 2:122428583-122428605 TTTTTCTTCCTCTTGGTTTCTGG + Intergenic
937623595 2:124018575-124018597 TTATTTTTCCTTTTGCATGAAGG - Intergenic
939712676 2:145542307-145542329 TTATTCTCTCTCTTTCACTATGG + Intergenic
940538596 2:154980665-154980687 TGACTCTTCATCTAGCATTAGGG + Intergenic
941466212 2:165830452-165830474 GTATCCTTCCTCTTGCACTTTGG + Intergenic
942336177 2:174888801-174888823 TTGTTTTTCCTCTTGCCTCAGGG + Intronic
942861337 2:180616247-180616269 GCATTCTTCCTCTTGCATTGCGG + Intergenic
942944430 2:181657219-181657241 TTATTCTTCCTCTTGCAGCTGGG - Intronic
943132666 2:183874213-183874235 TTTTTCTTTCTCTTTCATTTTGG + Intergenic
943530588 2:189075519-189075541 TTATTCTTCAATTTGCAATATGG - Intronic
943724306 2:191237191-191237213 TTATTCTCTTTTTTGCATTAAGG + Intergenic
943914465 2:193611148-193611170 TTATTCTCCCCATTGCATAAAGG - Intergenic
944071938 2:195680727-195680749 TTTTTCTTCCTCTTTCCTTTCGG - Exonic
945705234 2:213222108-213222130 TTATTCTTCCCATTGCTTTCTGG - Intergenic
946520966 2:220464321-220464343 TAAATATTCCTCTTGGATTAGGG - Intergenic
946850670 2:223903606-223903628 GTATTTTTCATCTTTCATTAAGG - Intronic
948064984 2:235071163-235071185 TTATTCTTCCTTTGGCTTTGTGG - Intergenic
1169505475 20:6206902-6206924 TTATTTTTCCTCTTTCTTTTTGG + Intergenic
1169921435 20:10738292-10738314 TTTTTCTTTTTCTTGCCTTATGG - Intergenic
1170471794 20:16675161-16675183 TCATTCTACTTCTTGCATTAGGG - Intergenic
1170904696 20:20502950-20502972 TTATTCTTCAACTTGCCTTGTGG - Intronic
1173072018 20:39777270-39777292 TTTTTCTTCTTTTTGCTTTAAGG - Intergenic
1173851735 20:46222797-46222819 TAATTCCTCCTCTGGCATTGGGG + Intronic
1174674873 20:52344219-52344241 TTGTTTTCCCTCTTGTATTATGG + Intergenic
1175042346 20:56065894-56065916 TCATTTTTCCTCTTACATTTAGG - Intergenic
1175230416 20:57470253-57470275 TTATTCTTCCTGTCACTTTAAGG - Intergenic
1177307470 21:19337952-19337974 TTATACTTCTTCTTACATTTAGG - Intergenic
1177431806 21:20998888-20998910 TTTTTTTTCCTCTGGGATTATGG + Intronic
1177454816 21:21323159-21323181 TTTTTCTTCCTCTGTAATTATGG - Intronic
1178113738 21:29396128-29396150 TAATAGTTCTTCTTGCATTAGGG + Intronic
1180138982 21:45879716-45879738 TTATACTTCCTCTTTGACTAGGG - Intronic
1181594692 22:23906690-23906712 ATATTCTGCCTCTTGCAATATGG - Intergenic
1183140778 22:35936732-35936754 TTTTTCTTTCTTTTGCAGTAGGG - Intronic
951308181 3:21092345-21092367 TTTTTCTTCCTGTTGCCTTGAGG + Intergenic
952188532 3:30997309-30997331 TGATTCTTGTTCTTGAATTAGGG + Intergenic
952554101 3:34512286-34512308 TTATTCTTCAGCTTTAATTAAGG - Intergenic
954189956 3:48952458-48952480 TTATTATTACTGTTGCATAAGGG + Intronic
954472965 3:50714812-50714834 TTATTCTTTCTCTTGCCTTTTGG + Intronic
955634894 3:61016958-61016980 TCATTACTACTCTTGCATTAGGG - Intronic
956585710 3:70862243-70862265 TTATTCAGCCTATTGCAATAAGG - Intergenic
957017151 3:75080279-75080301 TTATTTTTCTTTTTTCATTATGG - Intergenic
957823522 3:85410312-85410334 CTAGTGTTCCTCTAGCATTAGGG + Intronic
958862117 3:99457159-99457181 TTATTCTTAGTCTGGCATTGAGG + Intergenic
959189208 3:103088507-103088529 TCATTCTTCCTTTTTCATGAAGG - Intergenic
960314385 3:116158356-116158378 TACTTCTTCCTCTTGCCTGATGG - Intronic
960729313 3:120707830-120707852 CTATTCTTTCTCTTTCATTTGGG + Intronic
962886509 3:139632773-139632795 TTATTCAGCCTCTTGCAGTGAGG - Intronic
962965517 3:140350118-140350140 TGATTCTGCCTCTTGCCTTGTGG + Intronic
963014180 3:140805217-140805239 TTATTCTTTCTCTTGTCTGATGG + Intergenic
963660643 3:148124111-148124133 TTATTTTTCCTCTTGTTTAATGG - Intergenic
963877768 3:150495793-150495815 TTATTTTTCCAGTTCCATTAAGG - Intergenic
964711828 3:159679325-159679347 TTATTCTCCCAGTTGCATTCAGG + Intronic
964856264 3:161149308-161149330 ATGTTCTTCCTCTTGCTTTCAGG + Intronic
965120630 3:164550478-164550500 TTATTTTTCCTCTTGTTATAGGG + Intergenic
967602939 3:191411022-191411044 CTATACTTCCTCTGGTATTAGGG + Intergenic
968990336 4:3906760-3906782 TTAATTTTCATCTTTCATTATGG + Intergenic
969192760 4:5535648-5535670 CTGTTCTTCCTCTTTCTTTAAGG + Intergenic
970092402 4:12425503-12425525 TTTTTCTTCTTCTTTCATTTCGG + Intergenic
971020953 4:22534799-22534821 TTATTCTTACTGTTGCAATAGGG - Intergenic
971990205 4:33882608-33882630 TTAGTCTTCCTCTTGAGCTAAGG + Intergenic
972649864 4:41006316-41006338 GAATTCTTCCTGTCGCATTATGG + Intronic
973076570 4:45935415-45935437 TTATGATTCCTCTTACATAAAGG + Intergenic
973158496 4:46987982-46988004 AGATTCTTCTTCTTGCATTCTGG + Intronic
973221826 4:47735289-47735311 GTATTCTGTCTCTTGCTTTATGG - Intronic
973656098 4:53049297-53049319 TTCACCATCCTCTTGCATTAAGG - Intronic
973997266 4:56471160-56471182 ATATTTTTCCTCATGGATTATGG + Intronic
976093772 4:81486174-81486196 CTGTTCTTGCTCTTGCATTAAGG + Intronic
976750635 4:88448589-88448611 TTGTTCTTACTCAAGCATTAAGG + Intergenic
977065515 4:92308657-92308679 TTATTCTTACTTCTGCACTAAGG + Intronic
977101873 4:92826324-92826346 TTAATCTTCCTCTCTCATTGAGG + Intronic
977392434 4:96428724-96428746 TAATTCTTCCTCTTTCTTGAAGG + Intergenic
977419229 4:96776269-96776291 TTATTTTTTCTTTTGCATTTAGG - Intergenic
977515160 4:98012939-98012961 TAATTCTTTCTCTTGCCTGATGG + Intronic
977679330 4:99781590-99781612 TTATTGATCCTCTTTCATTTGGG + Intergenic
977762652 4:100758527-100758549 TTTTCCTCCCTCTTGCATTTGGG - Intronic
978535999 4:109763465-109763487 TTATTTTTCCTCTTGTTTTTAGG - Intronic
978556911 4:109990836-109990858 TTCTTCTTCCTCTTCTTTTAAGG + Intronic
978617099 4:110608899-110608921 TTATCCTTTCTTTTGAATTAAGG - Intergenic
978661254 4:111129132-111129154 TTATTCCACCTCTTCCACTATGG + Intergenic
978714186 4:111822371-111822393 TTCTTATCCCTCTTGCATTTAGG + Intergenic
979151783 4:117326168-117326190 GGATTATTCCCCTTGCATTAAGG - Intergenic
979204243 4:118016563-118016585 TTATTCTTCCTTATGAATTGTGG - Intergenic
979845518 4:125505492-125505514 ATATTCTTCCTTTTGTATTTTGG - Intergenic
980938777 4:139252668-139252690 TTATTTTTTCACTTTCATTATGG + Intergenic
981119970 4:141038856-141038878 TTCTTCCTCTTCTGGCATTAGGG - Intronic
981529979 4:145742992-145743014 TTTTTCTTCCTCTTGCTCTTTGG - Intronic
982328868 4:154159000-154159022 TTATTCCTCCTCTAGCTTGATGG - Intergenic
982587655 4:157262772-157262794 TTATTCTGCCCCTTTCTTTAGGG - Intronic
983097133 4:163576066-163576088 TTTTTCTTCTTCTAGCTTTAAGG + Intronic
983144142 4:164191523-164191545 TTATTCTTCTTTTTGCTTTGAGG + Intronic
983798633 4:171899319-171899341 TCAGTCTTCCTGTTACATTATGG + Intronic
984053654 4:174898644-174898666 TTATTCTTCATCAGGCATTTAGG + Intronic
984385536 4:179052265-179052287 ATATTTTTCCTCTTGCATGTGGG + Intergenic
984633427 4:182085071-182085093 TTCCTCTTCCTCTTTCTTTATGG - Intergenic
986266420 5:6195181-6195203 TCATTCCTCCTCTTGCTTTTGGG - Intergenic
986432388 5:7693947-7693969 TCATCCTTCCTCTTGCACAATGG + Intronic
986548293 5:8924008-8924030 TTATTCTTCCTCTTGAAGAGGGG + Intergenic
987290070 5:16500433-16500455 TTATTCTTCTTCTTCCCTTCAGG - Intronic
987416342 5:17665747-17665769 TATTTCTTCCTCTTGCCTGATGG + Intergenic
987444805 5:18004606-18004628 TTATTCTTCCTTTTTCCTAAAGG + Intergenic
987898944 5:23985305-23985327 TCATTCTTCCATTGGCATTATGG - Intronic
987957968 5:24764637-24764659 TTATTGTTATTTTTGCATTATGG + Intergenic
988607693 5:32694132-32694154 ATATTCTTTCTCTTACATAATGG - Intronic
990101910 5:52201479-52201501 CTTTTCTTCCTTTTGCATCAAGG - Intergenic
990666442 5:58077812-58077834 TCATTCTTCCCATTGCATTTGGG + Intergenic
991569605 5:68040517-68040539 GTTTTCTTCCTCTTGAAGTAAGG + Intergenic
991577280 5:68118192-68118214 TCTTTCTTCCTCTTGACTTAGGG + Intergenic
992532174 5:77662929-77662951 TTATTTTCCCCCTAGCATTAAGG - Intergenic
992712478 5:79473384-79473406 CAATTCTTCCTCTTCCAATATGG + Intronic
994458313 5:100043467-100043489 TTATAGTTCATCTTGCATTCAGG - Intergenic
995014206 5:107291545-107291567 CAATTCTTCCTCTTGCAATGTGG - Intergenic
997083045 5:130763381-130763403 TTATTCATCCTCATGAATTATGG - Intergenic
998057376 5:139089967-139089989 TTATTCTTTTTCTTACATTGAGG - Intronic
998835495 5:146199266-146199288 TTGTTGGTCCTCTTCCATTAGGG - Intergenic
1000145976 5:158453740-158453762 TAATTCTTCCTCTTCCAGTGTGG + Intergenic
1000208946 5:159092868-159092890 AAATTCTTCCTCATACATTATGG - Intronic
1000710805 5:164574869-164574891 TTTTTCTTCCTCTTCCTTTGAGG - Intergenic
1000753461 5:165126246-165126268 TTATTCTCACTTTTGCATTTTGG - Intergenic
1000984446 5:167851498-167851520 TTATTCATCTTCTTGTTTTAAGG + Intronic
1004802394 6:19164057-19164079 TTATACTTCCCCTTTCATTTTGG - Intergenic
1005249017 6:23922928-23922950 TTTTTTTTCCTCCTGAATTATGG - Intergenic
1005441877 6:25878825-25878847 TTATTCTTCCTTTTGTATCTTGG + Intronic
1005491187 6:26348882-26348904 TTATTTTTCTTTTTGTATTAGGG + Intergenic
1006062488 6:31434220-31434242 TTATTGGACCTCTTCCATTATGG + Intergenic
1006103441 6:31701554-31701576 ATTTTCTTCCTCTGGAATTATGG + Intronic
1008699602 6:54082615-54082637 TTATTCTCCCTTTAGCAATATGG + Intronic
1009381158 6:63031998-63032020 TTATTTTTCCCCTTTCATTTGGG + Intergenic
1009471798 6:64035225-64035247 TTTTTCTTCATCTAGGATTATGG + Intronic
1009975463 6:70667008-70667030 GTTCTCTTTCTCTTGCATTAAGG + Intergenic
1009987408 6:70797605-70797627 TTATTATTTCTCTCACATTATGG + Intronic
1010155987 6:72793533-72793555 TTATTTTTCCCCTTATATTATGG + Intronic
1011492394 6:87905862-87905884 TTTGTTTTCCTCTTGCCTTATGG - Intergenic
1011668787 6:89662239-89662261 TTTTTCTTCCTCTGACATTTAGG - Exonic
1011674275 6:89716223-89716245 TCATTCTTGATCTTGCAGTAAGG - Intronic
1011985535 6:93439327-93439349 TTATCCATCCTCTTACAATATGG + Intergenic
1013883912 6:114938495-114938517 TTATTCTGCCCCTTGAAATATGG + Intergenic
1013956704 6:115850568-115850590 TAATTCTTCTTCTTGGATGAGGG - Intergenic
1014746152 6:125203213-125203235 TTATTTTTCCTCATACACTATGG + Intronic
1014746482 6:125206919-125206941 TTATTTTTCCTCATGCAGTCTGG + Intronic
1015036159 6:128657161-128657183 TGATTCTTCCTCTTTGATGATGG + Intergenic
1015187887 6:130439357-130439379 TTCTTCTTCCTCTTCCAATCAGG - Exonic
1015333865 6:132012141-132012163 TTTCTCTTTCTCTTTCATTATGG - Intergenic
1015391473 6:132687045-132687067 ATCTTCTGCCTCTTGGATTAGGG - Intronic
1015734845 6:136388085-136388107 TTAGTCTTCTATTTGCATTAGGG - Intronic
1016011308 6:139139852-139139874 TTCTTATTCCCCTAGCATTATGG + Intronic
1016060817 6:139627928-139627950 TTATTCCTACTCTTGCACTTTGG + Intergenic
1016169487 6:140992729-140992751 TATTTCTTTTTCTTGCATTATGG - Intergenic
1018878621 6:167850974-167850996 TTCTTCTGCCTCCTGCATTCAGG + Intronic
1019939902 7:4281645-4281667 TTATTCTCCCTCTTGCTTTCTGG - Intergenic
1020283245 7:6662048-6662070 TGCTTCTTTCTCTTGTATTACGG - Intergenic
1023214958 7:37851984-37852006 TTATTCATCATCTTGAACTAAGG - Intronic
1024267193 7:47615845-47615867 TTATTCTTTTTTTTGAATTAGGG + Intergenic
1024426598 7:49232957-49232979 TTATTTTTCCTTTTGCATTAAGG + Intergenic
1027261428 7:76467563-76467585 CTATTATTCCTCTTTCTTTAAGG + Intronic
1027312811 7:76965672-76965694 CTATTATTCCTCTTTCTTTAAGG + Intergenic
1027804377 7:82798037-82798059 TTATTCTTGTTTTTGCTTTATGG - Intronic
1028349275 7:89824783-89824805 TTATCCTTCCTCTTATTTTAAGG + Intergenic
1029159896 7:98544106-98544128 TAATTCTTACTCCTGCATTTAGG - Intergenic
1030124650 7:106142378-106142400 CTGTTCTTCCTCTTGTATAAAGG - Intergenic
1030887726 7:114959378-114959400 TTATTCTTCCTCTTAATTGAAGG + Intronic
1031502073 7:122531252-122531274 TTCTTCTTTCTCTTCCATTGTGG - Intronic
1031757879 7:125668755-125668777 TCATTCTTTCTCTTTCATGACGG - Intergenic
1032356218 7:131213347-131213369 TTATCCTTCCTCTTGCCTTAAGG + Intronic
1032655570 7:133925607-133925629 TGATTCTTCTTCTTTCATTCAGG - Intronic
1033782371 7:144687054-144687076 CTTGTCTTCCTCTTGCATTTTGG - Intronic
1034369329 7:150580918-150580940 TTATTCTTCCCCTTGCATTCAGG + Intergenic
1035933117 8:3806210-3806232 TTTTTCTTCCTCTCAGATTATGG + Intronic
1036551806 8:9822671-9822693 TTGTTCCTCCTCTTGCCTGATGG + Intergenic
1037719145 8:21428064-21428086 TTATTTATTCTATTGCATTAAGG + Intergenic
1038215423 8:25557721-25557743 TTTTTTTTCTTATTGCATTACGG + Intergenic
1038779738 8:30559736-30559758 TTTTTCTTCCTATTTCATGAAGG - Intronic
1039078019 8:33709972-33709994 TTATTTTGCCTCTTGGTTTAGGG + Intergenic
1039476844 8:37843313-37843335 TGGTTCTTCCTCTGGCCTTACGG - Exonic
1040016316 8:42703080-42703102 TTTTCCTTCCTCTTTCATTGAGG + Intronic
1041401862 8:57454672-57454694 TTATTGTTCCTCCTGGATTGAGG - Intergenic
1041471147 8:58210333-58210355 TTATTCCTCTTCTTCCAATATGG + Intergenic
1041710343 8:60888683-60888705 CTTTTCATCCTCTTGCTTTAGGG - Intergenic
1042261461 8:66864622-66864644 TTTTTCTTTCTCTTGCCTGATGG - Intergenic
1042690863 8:71497143-71497165 TGATTCTTCTTCTTCCATTGTGG - Intronic
1042901091 8:73728378-73728400 TTATTCTTCCTTTTTCAAGATGG + Intronic
1042979426 8:74508707-74508729 TTATTCATTCTTTTGAATTAAGG - Intergenic
1043270438 8:78326640-78326662 TGTTTCTTCCTCTTTCATTGTGG - Intergenic
1043644840 8:82504305-82504327 TTAATTTTCCTTTTACATTATGG - Intergenic
1045139066 8:99259244-99259266 TTTTTCTTCCTCTTCTATCATGG + Intronic
1045955270 8:107898478-107898500 TTGTAATTCCTCTTGCATTAGGG + Intergenic
1046341119 8:112856067-112856089 TAATTGTTCTTCTTGCATTAAGG - Intronic
1046350977 8:113011925-113011947 TTATTTTACTTCTTGCTTTATGG - Intronic
1046354675 8:113066088-113066110 TTATTCTTGCTCTTGTCTCAAGG + Intronic
1047027084 8:120835948-120835970 CAACTCTTCCTCTTCCATTAAGG - Intergenic
1047135261 8:122070555-122070577 GTATTTTTCCTCTTCTATTAGGG + Intergenic
1047136221 8:122081412-122081434 TTATTGTTCCTCTAACAATAAGG + Intergenic
1047247003 8:123154842-123154864 TTACTCTTGCTCTTGCTTCACGG - Intergenic
1047357501 8:124137513-124137535 TTTTTCTTCCTTTGGCATTCAGG + Intergenic
1050333619 9:4569999-4570021 TAATTCTTGCTCATTCATTATGG - Intronic
1051541365 9:18223043-18223065 TTATTCTTCCTCATTCATTTGGG + Intergenic
1052003648 9:23319597-23319619 TCATTCATCCTCTTCAATTAGGG + Intergenic
1052140150 9:24971064-24971086 TCATTCTTCCTCATTCATTGAGG + Intergenic
1052648876 9:31273689-31273711 TTGTTTTTCCTCTTGGATTTTGG + Intergenic
1055243705 9:74216680-74216702 GTATTCTTTCTATTGTATTATGG + Intergenic
1055428101 9:76216524-76216546 TTATCCTTCTTGTTGCCTTATGG - Intronic
1055439827 9:76326805-76326827 TTATTTTTGCTCTTGGCTTATGG - Intronic
1055443451 9:76359129-76359151 TTATCCTTGCTCTTCAATTACGG - Exonic
1055735379 9:79323476-79323498 TTATTTTTCCTCATGCACTTTGG + Intergenic
1055850338 9:80620539-80620561 TTATTTTTGCTCTTGATTTAGGG + Intergenic
1057552818 9:96064545-96064567 TTTTCCTTCCTCTTAAATTAGGG - Intergenic
1058104116 9:100950555-100950577 TTCTTCTTCCTTTTGTTTTATGG - Intergenic
1058331611 9:103768315-103768337 TTTTTCTTTCTCTTGAATCAAGG + Intergenic
1059223394 9:112647503-112647525 TTATTCATCCTCATGCATTGTGG - Intronic
1059831791 9:118104368-118104390 TTAGTCTTCCCCTTACCTTATGG + Intergenic
1060714175 9:125906391-125906413 TTCTTTTTCCTCTTGCAGGAAGG - Intronic
1060951076 9:127603559-127603581 GCATTCTTCCTCTTGCTTTCTGG + Intergenic
1185498545 X:578863-578885 TTATCCTTCCTTCTGCTTTAGGG + Intergenic
1186161902 X:6785913-6785935 TTTCTCTTCCACTTGCATTGAGG + Intergenic
1186648821 X:11536651-11536673 TTATTTTTCAACTTTCATTAAGG - Intronic
1186733626 X:12437551-12437573 TCATTCTTACTCTTGAATGATGG + Intronic
1186753484 X:12645747-12645769 TTAATCTTCCTCGGACATTAAGG + Intronic
1188666825 X:32833892-32833914 TTAGTATACCTCTTGCTTTAAGG - Intronic
1190743573 X:53306682-53306704 TTATTCCTTCACTTTCATTATGG - Intronic
1191731481 X:64340407-64340429 TTACTCTTCCCCCTCCATTAAGG - Intronic
1191883347 X:65863992-65864014 TTATTCTTCCTCTCCCAACACGG + Intergenic
1193677625 X:84475860-84475882 TTATTTTTCATCTTGGATAAAGG + Intronic
1194388889 X:93292048-93292070 TTAATCTTCTTTTAGCATTAAGG + Intergenic
1194444165 X:93966728-93966750 TTATTTTCCTTCTTGTATTAAGG + Intergenic
1194512023 X:94808666-94808688 TTTGTCTTCCTCTAGCATTGGGG + Intergenic
1195315232 X:103670998-103671020 TTTTTCTTCCTAATTCATTATGG - Intergenic
1197109718 X:122757774-122757796 TTATTGTTCCAATTGCTTTAAGG + Intergenic
1198642812 X:138775405-138775427 TTATTCTTCATTTTCCTTTATGG + Intronic
1199428805 X:147735362-147735384 TAATTCTTCCTCTTACAGTGTGG + Intergenic
1200712542 Y:6500889-6500911 TCATTCTTTCTCTTGCCTGATGG + Intergenic
1201021376 Y:9661149-9661171 TCATTCTTTCTCTTGCCTGATGG - Intergenic
1202051474 Y:20785363-20785385 TTATTCTTCATCTTGACTTTTGG + Intergenic
1202604581 Y:26627691-26627713 TAATTCTTCTTCTTCCATTGTGG - Intergenic