ID: 932993457

View in Genome Browser
Species Human (GRCh38)
Location 2:76817181-76817203
Sequence GCATGCACTCCTGGCACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932993457 Original CRISPR GCATGCACTCCTGGCACTCA TGG (reversed) Intronic
902723775 1:18322214-18322236 GCATCGGCTCCTGGAACTCAAGG + Intronic
902813032 1:18900187-18900209 GCAGAGATTCCTGGCACTCAAGG + Intronic
902959374 1:19951670-19951692 GCCTGCACTCCTAGCACTTTGGG + Intergenic
903189322 1:21647983-21648005 TCATGATCTCCTGGCATTCAAGG - Intronic
904052225 1:27646591-27646613 TCAAGCACTCCTGGCCCCCAAGG - Intergenic
904148841 1:28419241-28419263 GCCTGTAATCCTGGCACTCTGGG - Intronic
904517725 1:31069512-31069534 GCCTGTAATCCTGGCACTCTGGG - Intergenic
905293284 1:36938059-36938081 CCATGCCCTTCAGGCACTCATGG + Intronic
906633881 1:47395264-47395286 GCCTGTAATCCTGGCACTCTGGG - Intergenic
910097376 1:83538944-83538966 ACATGCAATCCTAGCACTCTGGG + Intergenic
911321565 1:96419290-96419312 TCATTAACTCCTGCCACTCAAGG + Intergenic
911659668 1:100487297-100487319 GCCTGTAATCCTGGCACTCTGGG + Intronic
914196837 1:145452076-145452098 GCCTCCTCTCCTGGCCCTCAAGG + Intergenic
914757706 1:150573992-150574014 GCCTGTAATCCTGGCACTCTGGG + Intergenic
915028046 1:152851558-152851580 ACATGCTCTCTTGGCATTCATGG + Intergenic
915985998 1:160465393-160465415 GCCTGTAATCCTGGCACTCTGGG + Intergenic
917792901 1:178511108-178511130 GCTTGCAATCCTAGCACTCTGGG + Intergenic
919634512 1:199990356-199990378 GCTTGCAGTCCTAGCACTCTGGG - Intergenic
920026473 1:203001578-203001600 GCCTGTAATCCTGGCACTCTGGG - Intergenic
920193057 1:204207197-204207219 GCAGGCACACCTGTCACTCCTGG - Intronic
920217686 1:204373030-204373052 GCCTGTAGTCCTAGCACTCAGGG - Intronic
921203278 1:212826807-212826829 GCCTGTAATCCTGGCACTTAGGG + Intergenic
921849318 1:219917970-219917992 GCCTGTAATCCTGGCACTCTGGG - Intronic
922291717 1:224213960-224213982 GCATGCACTAGTGGCTCCCAGGG - Intergenic
922382316 1:225043168-225043190 GCCTGCAATCCTGGCACTCTGGG + Intronic
923054406 1:230415004-230415026 GCATGCAATCCTAGCACTTTGGG + Intronic
923773370 1:236957213-236957235 GCATGAGCTCCCTGCACTCATGG - Intergenic
923967270 1:239155890-239155912 GCACTCTCTCCTGGCAGTCAGGG - Intergenic
1062835204 10:630955-630977 GCAAGAGCTCCTGGCTCTCAGGG + Intronic
1063423822 10:5935888-5935910 GCACTCACGCCTGGCACGCAGGG - Intronic
1063708804 10:8457198-8457220 GCCTGCAGTCCTGGCACTTTGGG + Intergenic
1063716248 10:8529973-8529995 GAATGAACTACTGGCACCCAAGG - Intergenic
1066236643 10:33491269-33491291 GCAGTCACCCCTGGCACGCATGG + Intergenic
1066315511 10:34242114-34242136 GAATTCACTCCTGGAGCTCATGG + Intronic
1069546790 10:69334723-69334745 TCCTGTACCCCTGGCACTCACGG + Intronic
1071615862 10:87075660-87075682 GCCTGCAATCCTAGCACTCTGGG + Intronic
1071678988 10:87685428-87685450 GCCTGCAATCCTGGCACTTACGG + Intronic
1072728943 10:97831871-97831893 GCATGCATTCCCTGCCCTCAGGG + Intergenic
1072831370 10:98662150-98662172 GCCTGTAATCCTGGCACTCTGGG - Intronic
1075148727 10:119906833-119906855 GCATGTAATCCTAGCACTCTGGG - Intronic
1075758800 10:124839482-124839504 GCCTGTAATCCTGGCACTCTGGG - Intergenic
1076449524 10:130547106-130547128 GAATGCACCCCTGTCACCCAGGG + Intergenic
1077152237 11:1077556-1077578 GGATGCACTCATGGTGCTCAGGG + Intergenic
1078205818 11:9228487-9228509 GCTTGCAATCCTGGCACTTTGGG + Intronic
1079046187 11:17105847-17105869 GCCTGCAGTCCTAGCACTCTGGG + Intronic
1082843512 11:57709120-57709142 GCCTGTAATCCTGGCACTCTGGG + Intronic
1084551380 11:69845005-69845027 GCATGAACTCCTGGGATTCATGG + Intergenic
1085525312 11:77160424-77160446 GCATGGGCACCTGGGACTCAAGG - Intronic
1085933264 11:81112287-81112309 GCCTGCAATCCTGGCAGTCTGGG - Intergenic
1086754478 11:90542593-90542615 GCATGTAATCCTGGCACTTTGGG + Intergenic
1088257023 11:107912188-107912210 GGCTGCACTCCCGGCACTTAGGG - Intronic
1095220536 12:39608425-39608447 GCCTGTAGTCCTGGCACTCTGGG + Intronic
1095982881 12:47982855-47982877 CCCGGCACTCCTGGCACTGATGG - Exonic
1097023829 12:56039512-56039534 GCCTGTAATCCTGGCACTCTGGG + Intergenic
1101700496 12:107169365-107169387 GCAGGCCCTCCAGGCACACAGGG + Intergenic
1102379369 12:112450557-112450579 TCATGCATTTCTGACACTCAGGG - Intronic
1102413961 12:112744333-112744355 GCATGTAATCCTGGCACTTTGGG - Intronic
1103671960 12:122624525-122624547 GCCTACAATCCCGGCACTCAGGG - Intronic
1103758600 12:123232006-123232028 GCATTCACTCCTGTCCCTGAAGG - Intronic
1104042886 12:125141974-125141996 CCATTCACTCTTGGCACTCCAGG + Intronic
1104735912 12:131135991-131136013 ACCTGCCCTCCTGCCACTCAGGG + Intronic
1104752775 12:131250612-131250634 GCAGGCAGCCCTGGCTCTCAGGG + Intergenic
1104835149 12:131785317-131785339 GCAGCCACTCCTGGCCCTCCAGG + Intronic
1109138393 13:58682236-58682258 GCCTGTAATCCTGGCACTCTGGG - Intergenic
1110222474 13:73088528-73088550 ACCTGCAATCCTGGCACTTAGGG + Intergenic
1110308359 13:74017016-74017038 ACATGTACTCGTGGCATTCAGGG + Intronic
1112999149 13:105612087-105612109 GCATGCACTCCTGGATTTAAAGG + Intergenic
1113523268 13:110955181-110955203 GGATGCATTCCTGGCCCTCTGGG - Intergenic
1113562967 13:111298515-111298537 GCAAGGACTCCTGACACTCCAGG - Intronic
1113702037 13:112395315-112395337 GGATGCATTCCTGGCCCTCTGGG + Intronic
1114403481 14:22431747-22431769 GCCTGTAATCCTGGCACTCTGGG - Intergenic
1115257261 14:31416379-31416401 GCCTGCAATCCTGGCACTTTGGG - Intronic
1115575778 14:34709512-34709534 GCATGCAATCCTAGCACTTTTGG + Exonic
1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG + Intergenic
1117610320 14:57476378-57476400 AGATGCACTACTGGGACTCAGGG + Intronic
1118194365 14:63611077-63611099 GCCTGCAATCCTAGCACTCGGGG + Intronic
1119351248 14:73967545-73967567 GCCTGTACTCCTGGCACTTTGGG + Intronic
1121118706 14:91361972-91361994 GCCTGCAATCCTAGCACTCTGGG + Intronic
1121474937 14:94190346-94190368 GCCTGTAATCCTGGCACTCTGGG + Intronic
1122276444 14:100593122-100593144 GCATCCCATCCAGGCACTCAAGG + Intergenic
1122814512 14:104305911-104305933 GCATGCACACCCTGCACACAGGG - Intergenic
1123114501 14:105888488-105888510 GCACCCACTCCTGGGACTGAGGG - Intergenic
1124087659 15:26566464-26566486 GCATATACTCCTAGCACTCTGGG + Intronic
1125961128 15:43830785-43830807 GCCTGCACTCCCGGCACTTTGGG + Intronic
1126042107 15:44601518-44601540 GCATGTAATCCTAGCACTCTGGG - Intronic
1127220343 15:56873856-56873878 GCCTGCACTCCCTGCATTCAAGG - Intronic
1127601523 15:60542574-60542596 GCATGCACACCTCACACACACGG + Intronic
1127843215 15:62847730-62847752 GCCTGCACTCCTTGGAATCAGGG + Intergenic
1129048105 15:72755072-72755094 GCATGCCAGCCTTGCACTCACGG - Intronic
1130537698 15:84798806-84798828 GAACCCACTCCTGGCACTCCTGG - Exonic
1130664781 15:85860587-85860609 TCCTGCATTCCTGTCACTCACGG + Intergenic
1132846219 16:2002046-2002068 GCAAGAGCTCCTGGCACACAAGG + Intronic
1133128953 16:3664545-3664567 CCATGGCCTCCTGGCACTCCAGG + Exonic
1133213297 16:4274794-4274816 TCTTGAACTCCTGGGACTCAAGG + Intergenic
1136532445 16:30878583-30878605 GCCTGTAATCCTGGCACTCTGGG + Intronic
1137253619 16:46757899-46757921 GCAGGGACTCCTTGCATTCAGGG + Intronic
1137641924 16:50039632-50039654 GCCTGTAATCCTGGCACTCTGGG + Intergenic
1137744467 16:50810561-50810583 GCATGCTCTCTTGGCACTCTGGG - Intergenic
1140490118 16:75328323-75328345 GCCTGCAATCCTGGCACTTTGGG + Intronic
1142719024 17:1763928-1763950 GCCTGTACTCCTGGCACTTTGGG + Intronic
1142785356 17:2217749-2217771 GCCTGCAATCCTGGCACTTTGGG + Intronic
1143055540 17:4159261-4159283 GCATGCAATCCTGGCACTTTGGG - Intronic
1144235548 17:13257283-13257305 GCCTACGCTCCTGGCTCTCAGGG + Intergenic
1144846568 17:18222994-18223016 GCCTGTAATCCTGGCACTCTGGG - Intergenic
1145241022 17:21241174-21241196 CCATTCCCTCCTGGCTCTCAAGG + Exonic
1146081449 17:29784125-29784147 GCCTGCAATCCTGGCACTTTGGG + Intronic
1146494618 17:33310460-33310482 GGAGGCAATCTTGGCACTCAAGG - Intronic
1146911038 17:36648721-36648743 GCTTTGTCTCCTGGCACTCAAGG + Intergenic
1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG + Intergenic
1148845491 17:50527473-50527495 GCAGGCAGTCCTGGGACTCCAGG + Intronic
1149738137 17:59016132-59016154 GCCTGTAATCCTGGCACTCTGGG + Intronic
1151549664 17:74814811-74814833 GGATGCAGTCCTTGCCCTCAAGG + Intronic
1151824105 17:76514073-76514095 GCCTGCACTCCTGGCTCTCCTGG + Intergenic
1152703402 17:81830761-81830783 GCCTGTAATCCTGGCACTCTGGG + Intronic
1152829524 17:82488630-82488652 GCCTGCAGTCCTGGCACTTTGGG - Exonic
1153223251 18:2879964-2879986 GCCTGCAATCCTAGCACTCTGGG - Intronic
1155088190 18:22477653-22477675 CCATGCTCTCCTGGCATTTAAGG + Intergenic
1155686136 18:28553757-28553779 GCATGCCCTCCTGGCAATGATGG - Intergenic
1157552707 18:48592554-48592576 GCATCCACTCCTTGCCCACATGG - Intronic
1161369082 19:3899572-3899594 GCCTGTAATCCTGGCACTTAGGG - Intronic
1161615895 19:5270028-5270050 GCCTGCACTCTGAGCACTCAGGG - Intronic
1161621780 19:5301573-5301595 GCATGTAATCCTGGCACTTTGGG - Intronic
1161843461 19:6696333-6696355 CCATGCCCTCCTGGGACCCATGG + Intronic
1162137189 19:8562791-8562813 GCCTGTAATCCTGGCACTCTGGG - Intronic
1162545357 19:11325812-11325834 GCCTGTAATCCTGGCACTAAAGG + Intronic
1164426217 19:28144093-28144115 GCCTGTAATCCTGGCACTCTGGG - Intergenic
1165316953 19:35061804-35061826 GCCTGTAATCCTGGCACTCTGGG + Intronic
1165407973 19:35642330-35642352 GCCTGGACTCCTGGCTCTGAGGG + Intronic
1165908366 19:39207833-39207855 GCCTGTAATCCTGGCACTCTGGG + Intergenic
1165918463 19:39276478-39276500 GCCTCTAATCCTGGCACTCAGGG - Intergenic
1166142281 19:40811536-40811558 GCCTGGACTCCTGGATCTCAGGG - Intronic
1166306237 19:41938449-41938471 GCATGGACTCCTGGGTCTGAGGG - Intergenic
1166525565 19:43507685-43507707 GCCTGGACTCCTGGCTCTGAGGG - Intronic
1166662117 19:44654089-44654111 GCCTGGACTCCTGGGACTGAGGG + Intronic
1166759845 19:45217777-45217799 ACATCCACTCCGGGCACCCATGG + Intronic
1167202934 19:48079710-48079732 GCCTGTAATCCTGGCACTCTGGG + Intronic
1167266052 19:48483366-48483388 GCCTGGACTCCTGGGTCTCAGGG - Intergenic
1167367941 19:49064603-49064625 GCATGGACTCCTGGGTCTGAAGG - Intronic
1167689339 19:50975494-50975516 GCCTGCACTCCTGGGTCTGAGGG + Intergenic
1167705141 19:51077603-51077625 GCCTGGACTCCTGGGTCTCAAGG + Intronic
1167705561 19:51079208-51079230 GCCTGGACTCCTGGGTCTCAAGG - Intronic
1167705580 19:51079279-51079301 GCCTGGACTCCTGGGTCTCAAGG - Intronic
1167721718 19:51184382-51184404 GCTTGCACCCCTGTCTCTCATGG + Intergenic
1167798651 19:51726728-51726750 GCCTGGACTCCTGGGTCTCAGGG - Intergenic
1167931044 19:52865060-52865082 GCCTGCAATCCTGGCACTTTGGG + Intronic
1168250215 19:55137560-55137582 GCCTGCACTCCTGGGTCTGAGGG - Intronic
1168277300 19:55284967-55284989 GCCTGCACTCCTGGGTCTGAAGG + Intronic
1168306249 19:55437869-55437891 GCCTGCACTCCTGGGTCTGAAGG - Intronic
925065177 2:923946-923968 GCCTGTAATCCTGGCACTCTGGG - Intergenic
925118073 2:1397385-1397407 GCAGGCACTCAGGGCACTCAGGG - Intronic
927926515 2:27017415-27017437 ACAGGCACTGCTGCCACTCATGG + Intronic
929375481 2:41281788-41281810 GCCTGTAATCCTGGCACTCTGGG + Intergenic
931398255 2:61907362-61907384 GCCTGTAATCCTGGCACTCCGGG - Intronic
932993457 2:76817181-76817203 GCATGCACTCCTGGCACTCATGG - Intronic
933666040 2:84965932-84965954 GCCTGTAATCCTGGCACTCTGGG + Intergenic
934523354 2:95033516-95033538 GCCTGTAATCCTGGCACTCTGGG + Intronic
936283031 2:111159338-111159360 GAATGCTACCCTGGCACTCAGGG + Intronic
936486027 2:112926478-112926500 GCCTGCAATCCTAGCACTCCAGG - Intergenic
937720570 2:125090455-125090477 GCATGTAATCCTGGCACTTTGGG + Intergenic
937932205 2:127215608-127215630 GCATGTAATCCTAGCACTCTGGG + Intronic
938078314 2:128353997-128354019 GCACACAATCCAGGCACTCATGG - Intergenic
940652508 2:156452166-156452188 GGCTGCACTCCTGGCACTTTGGG + Intronic
948260082 2:236597704-236597726 GCAGGCGCTCCTGGCAGTCTTGG + Intergenic
948701463 2:239763216-239763238 GGAGGCACTCCTTCCACTCACGG - Intronic
1169661705 20:7985530-7985552 GCCTGTAATCCTGGCACTCTGGG - Intronic
1169978170 20:11353714-11353736 GCATGCTCCCCTGTCCCTCAAGG + Intergenic
1170498628 20:16951487-16951509 GCCTGTAATCCTGGCACTTAGGG + Intergenic
1170869375 20:20190857-20190879 GCGTGCAATCCTAGCACTCTGGG + Intronic
1170926330 20:20727779-20727801 GAATGAACTCCAGGCATTCATGG + Intergenic
1171375837 20:24693751-24693773 GTATGCACTGCAGGCACTCATGG - Intergenic
1172026693 20:31953539-31953561 GCATGGACACCAGGCACTCCTGG - Intergenic
1172764091 20:37341839-37341861 GAAGCCACGCCTGGCACTCAGGG + Intergenic
1173808822 20:45943653-45943675 GGATGCACTCCTGCCAGTCAAGG - Exonic
1174614819 20:51827736-51827758 GCTTGCAATCCTAGCACTCTGGG + Intergenic
1176303531 21:5111369-5111391 CCCTGCTCTCCTGGCGCTCAGGG + Intergenic
1179443227 21:41410813-41410835 GCAGGCACTCCTGGTCCCCAGGG + Intergenic
1179853499 21:44150581-44150603 CCCTGCTCTCCTGGCGCTCAGGG - Intergenic
1181146885 22:20854890-20854912 GCCTGCAATCCTGGCACTTTGGG + Intronic
1182634198 22:31711519-31711541 GCATGCAATCCTAGCACTTTGGG + Intronic
1183229621 22:36573589-36573611 GCCTGCACTCCCGGCACTTTGGG - Intronic
1183521762 22:38299765-38299787 GCCTGCAGTCCTGGCACTTTGGG - Intronic
1183565385 22:38610800-38610822 GCCTGCAATCCTGGCACTTTGGG + Intronic
1184016682 22:41791225-41791247 GCTTGTAATCCTAGCACTCAGGG + Intronic
1184252526 22:43268866-43268888 GCCTGCAGTCCTGGCCCTCCAGG - Intronic
1184706890 22:46220680-46220702 GCCTGTAATCCTGGCACTCTGGG + Intronic
1185137102 22:49079392-49079414 GGCTTCACTCTTGGCACTCACGG + Intergenic
949544922 3:5064672-5064694 GCCTGTAATCCTGGCACTTAGGG + Intergenic
950329475 3:12145140-12145162 GCATGCACTCCCAGCACTTTGGG + Intronic
950873310 3:16247919-16247941 GCATGCACATGTGGCACTCCAGG + Intergenic
951031113 3:17882521-17882543 GCCTGTAATCCTGGCACTCTGGG - Intronic
951727382 3:25774942-25774964 GCAGGCACTCCTGGCCACCAAGG - Intronic
953156980 3:40384518-40384540 GCATGTAATCCTAGCACTCTGGG - Intergenic
953302503 3:41792913-41792935 GCCTGCAATCCCAGCACTCAGGG + Intronic
954196799 3:49001889-49001911 GCCTGCATTCCTTGCTCTCATGG + Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
955107347 3:55910967-55910989 GGATGCAATCCCTGCACTCATGG + Intronic
955225289 3:57055419-57055441 GCCTGTAATCCTGGCACTCTGGG - Intronic
955498801 3:59563784-59563806 CCAAACTCTCCTGGCACTCACGG - Intergenic
956490575 3:69767322-69767344 GCATGTAATCCTGGCACTTTGGG + Intronic
956516371 3:70053043-70053065 GCATACAGTGCTGTCACTCATGG + Intergenic
959606847 3:108250375-108250397 GCAGGCTTTCCTGGAACTCAGGG - Intergenic
960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG + Intronic
961722580 3:128906600-128906622 GCATGCGCTCCTGGCCCCTAGGG + Intronic
962701857 3:138008342-138008364 GCCTGCAATCCTGGCACTTTGGG + Intronic
968227471 3:196982928-196982950 GCCTGCAATCCTGGCACTTTGGG - Intergenic
968623778 4:1616875-1616897 GCCTGCAATCCCGGCACTCTGGG + Intergenic
974929617 4:68347125-68347147 AGATGTACTCCGGGCACTCAGGG + Intronic
975080653 4:70276080-70276102 ACATGTAATCCTGGCACTTAGGG + Intergenic
976279210 4:83310405-83310427 GCCTGTAATCCTGGCACTCTGGG + Intronic
976643241 4:87361506-87361528 GCCTGTAATCCTGGCACTCTGGG + Intronic
976694799 4:87907976-87907998 GCATGTAATCCTGGCACTTTGGG + Intergenic
977113957 4:92997246-92997268 ACATGAACTCCTTTCACTCAAGG - Intronic
980381992 4:132033881-132033903 GCCTGTAATCCTGGCACTCTGGG - Intergenic
981508450 4:145528499-145528521 GCCTGTAATCCTGGCACTCCGGG - Intronic
982602400 4:157468989-157469011 GCCTGCACTCTTGGCCATCATGG - Intergenic
983436763 4:167725147-167725169 GCCCCCACTTCTGGCACTCAGGG + Intergenic
983845679 4:172514749-172514771 GTAGGCACTCCTGGTCCTCAGGG - Intronic
984010419 4:174364499-174364521 GCCTGCAATCCTGGCACTTTGGG + Intergenic
984741587 4:183169105-183169127 GCCTGCAATCCTGGCACTTTGGG - Intronic
985429831 4:189868459-189868481 GCCTGTAATCCTGGCACTCTGGG + Intergenic
986720951 5:10561495-10561517 GCTTGAACTCCTGGGGCTCAAGG + Intergenic
991964319 5:72076255-72076277 GCATGCAATCCTAGCACTTTGGG + Intergenic
993025201 5:82637319-82637341 TCTTCCACTGCTGGCACTCAGGG + Intergenic
994269763 5:97762947-97762969 CCATGCACTTCTGTCAGTCAAGG - Intergenic
996466013 5:123803471-123803493 GCATGCAAGCCTGGCAGTCATGG - Intergenic
996756626 5:126943024-126943046 GCCTGTAATCCTGGCACTCTGGG + Intronic
997587129 5:135050184-135050206 GCATGCCCTCATGGCACACCAGG + Intronic
998301234 5:141022906-141022928 GCCTGCAATCCTGGCACTTTGGG + Intergenic
999239007 5:150116836-150116858 GTGTGCACTCCTGGCACATATGG + Intronic
1000115565 5:158150313-158150335 GAATGCCATCCTGGCACTGATGG + Intergenic
1001248059 5:170120453-170120475 TAATGCAGTCCTGGCACTTATGG + Intergenic
1001368134 5:171165686-171165708 GCATGTACTCCTGGAATGCAGGG - Intronic
1002082992 5:176748514-176748536 CCGGGCACTCCTGGCCCTCACGG + Intergenic
1002882611 6:1266175-1266197 CCAAGCACACCTGACACTCATGG + Intergenic
1004357814 6:14945287-14945309 GCCTGCAATCCTGGCACTTTGGG + Intergenic
1005335454 6:24791771-24791793 GCCTGCAATCCTGGCACTTTGGG - Intergenic
1005865133 6:29931781-29931803 GCATTCACTCCTGACCCTGAGGG - Intergenic
1005867452 6:29946869-29946891 GCATTCACTCCTGACCCTGAGGG - Intergenic
1006239736 6:32666703-32666725 CCATCCAATCCTGCCACTCACGG - Intronic
1007422130 6:41725982-41726004 GCCTGCAATCCTGGCACTTTGGG + Intronic
1012499576 6:99874219-99874241 GCTTCCCCTCCTGGCCCTCAGGG + Intergenic
1013357902 6:109362779-109362801 GCATACAGTCCTGGCCCTCCGGG - Intergenic
1017141460 6:151194124-151194146 GCATGTATTCCTAGCACTCTGGG + Intergenic
1018918494 6:168153924-168153946 GCCTGTAATCCTGGCACTCTGGG + Intergenic
1019453645 7:1113347-1113369 GCGGGCACTCCTGGCTTTCAGGG - Intronic
1019587164 7:1811854-1811876 GCATGCACCACTGCCACTCCTGG - Intergenic
1019610921 7:1936233-1936255 GCAGGCCCTGCTGGCCCTCATGG + Intronic
1019694060 7:2434826-2434848 GCCTGCAATCCTGGCACTTTGGG + Intergenic
1023860078 7:44213292-44213314 GCACCCACTCCTGGTGCTCAAGG - Exonic
1024773841 7:52758718-52758740 GCATGAACTCCTGGGGCTTAGGG + Intergenic
1024971677 7:55077697-55077719 GCAAGAACTCCAGGCTCTCATGG + Intronic
1025534638 7:61932666-61932688 GCCTGTAATCCTGGCACTCTGGG - Intergenic
1026551996 7:71376690-71376712 GCATGTAATCCTGGCACTTTGGG + Intronic
1026804445 7:73421232-73421254 GCATATAATCCTGGCACTCTGGG + Intergenic
1026856477 7:73758522-73758544 GCTTGCAATCCTGGCACTTTGGG - Intergenic
1026943871 7:74304168-74304190 GCCTGCAATCCTAGCACTCTGGG - Intronic
1026980769 7:74525361-74525383 GGGTGCAGTCCTGGCCCTCAGGG - Intronic
1027715349 7:81662474-81662496 GCATGTAATCCTGGCACTTTGGG + Intergenic
1028763712 7:94526096-94526118 TCATCCATTCCTGTCACTCAGGG + Intronic
1028801764 7:94973974-94973996 GCCTGCAATCCTAGCACTTAGGG - Intronic
1029193942 7:98791287-98791309 GCAGGCTCTCCAGGCACTCCTGG - Intergenic
1030112958 7:106042092-106042114 GAATCTACTCCTGGCACACAGGG - Intergenic
1032913532 7:136461372-136461394 GCATGCTCCCCTTGCACACAGGG - Intergenic
1036005514 8:4657439-4657461 TCACGCACTCTTGGCATTCATGG + Intronic
1036640764 8:10582100-10582122 GCTTGTAATCCTGGCACTTAGGG - Intergenic
1037750727 8:21680452-21680474 TCCTGCACTCCTGTCACTAATGG + Intergenic
1041236896 8:55812266-55812288 GCCTGTACTCCTGGCACTTTGGG + Intronic
1043921571 8:85989422-85989444 GCCTGCAATCCTGGCACTTTGGG - Intronic
1044500102 8:92944536-92944558 GAATGAAATCCTGGCACTCATGG + Intronic
1046935436 8:119881260-119881282 GCCTGTAATCCTGGCACTCTGGG + Intronic
1047784111 8:128136833-128136855 GCATCCACTCCTGAGACTGAGGG + Intergenic
1049521546 8:143094014-143094036 GCCTGTAATCCTGGCACTCTGGG - Intergenic
1051815718 9:21103122-21103144 GCCTGTAATCCTGGCACTCTGGG - Intergenic
1053503362 9:38620752-38620774 GGATGCACTCCTGGGATTCCGGG - Intergenic
1055790929 9:79922228-79922250 GCATGCAGTGCTGACAATCAAGG - Intergenic
1056056652 9:82831593-82831615 AAATGCACTTCTGCCACTCAGGG + Intergenic
1057169807 9:92954936-92954958 GCCTGCATTCATGGAACTCACGG + Intronic
1061352512 9:130076770-130076792 GCCTGCAGTCCTAGCACTCTGGG - Intronic
1062697896 9:137884766-137884788 GCCTCCTCTCCTGGCCCTCAAGG - Intronic
1185648379 X:1631171-1631193 GCCTGCAATCCTGGCACTTTGGG - Intronic
1186466290 X:9786492-9786514 CCATGCACTCCGGGCAGTCCCGG - Exonic
1188026360 X:25214026-25214048 CCATGCAATCCTGGCTCTCAGGG - Intergenic
1190013654 X:46807488-46807510 GCATGAACTGCTGGTAGTCAAGG + Intergenic
1191879221 X:65828107-65828129 GTAGGCACTCCTGGCCCCCAAGG + Intergenic
1192569413 X:72190691-72190713 GCCTGTACTCCTGGCACTTTGGG + Intronic
1193144812 X:78065724-78065746 GCCTGCAATCCTAGCACTCTGGG + Intronic
1193203004 X:78714667-78714689 GGAGGCACTCCTGGTACCCAGGG + Intergenic
1193784030 X:85736709-85736731 GCCTGCACTCCTCTCACTCTAGG - Intergenic
1193842868 X:86429820-86429842 GCCTGTACTCCTGGCACTTTGGG - Intronic
1195221934 X:102753040-102753062 GCCTGTAATCCTGGCACTCAGGG - Exonic
1195615111 X:106905890-106905912 GCATGCTCTCCTGGAGCCCAGGG + Intronic
1197968258 X:132088288-132088310 GCCTGTAATCCTAGCACTCAGGG + Intronic
1198079473 X:133225598-133225620 GCCTGTAGTCCTAGCACTCAGGG + Intergenic
1198371753 X:135996289-135996311 GCCTGTACTCCTAGCACTCTGGG - Intronic
1199090903 X:143691449-143691471 GCATGTAATCCTGGCACTTTGGG - Intergenic