ID: 932998879

View in Genome Browser
Species Human (GRCh38)
Location 2:76895798-76895820
Sequence ACTTCCATGCAGTCTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932998875_932998879 15 Left 932998875 2:76895760-76895782 CCAATTCTGTTTTTTATAAAAAA 0: 1
1: 0
2: 14
3: 203
4: 1956
Right 932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 182
932998874_932998879 16 Left 932998874 2:76895759-76895781 CCCAATTCTGTTTTTTATAAAAA 0: 1
1: 1
2: 12
3: 215
4: 1913
Right 932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932998879 Original CRISPR ACTTCCATGCAGTCTGTGGA GGG Intronic
900716111 1:4145448-4145470 ACTGACATGCTGTCTGTGGTTGG + Intergenic
900864797 1:5260593-5260615 CCCTCCATGGAGTGTGTGGAAGG + Intergenic
904706527 1:32394939-32394961 ACTTAGATGCAGCCTTTGGAGGG + Intergenic
904866332 1:33581915-33581937 ACTGCCATGCAAACTGTGAAGGG + Intronic
904969525 1:34408217-34408239 ACTTCCAGGAAGGCTGTGGAAGG - Intergenic
906934935 1:50206234-50206256 GCTTTCATGAAGGCTGTGGAAGG - Intergenic
916203535 1:162294263-162294285 ACTGCAGTGCAGTCTGAGGAAGG + Intronic
918151829 1:181803563-181803585 GCTTCTCTGCTGTCTGTGGAGGG + Intronic
920166545 1:204040286-204040308 GCTTTCATGGAGTCTGTGTATGG + Intergenic
921196589 1:212763074-212763096 AGTTCCAGGCAGTCTGCGCACGG - Intronic
922579167 1:226684394-226684416 CCTTCCATGCAGGCTTTCGAGGG - Intronic
922949275 1:229544643-229544665 ATTTCCATTCAGTCTGTAAAAGG - Intronic
923090487 1:230736833-230736855 GCTTCCCTGGAGTCTGTGGGAGG + Intergenic
924435656 1:244038741-244038763 TCTTCCCTGCAGCCTGTGGAAGG + Intergenic
1063372394 10:5530324-5530346 ACTTCCCTGCACTTTGAGGAAGG - Intergenic
1064814669 10:19245971-19245993 ACTTAAATGCAGTCAGTGGAAGG + Intronic
1065198809 10:23294038-23294060 AATTCAATGGAGCCTGTGGAGGG - Intronic
1065800168 10:29344711-29344733 TCCTCCATGCAGCCTGTGGGTGG - Intergenic
1068043386 10:51855977-51855999 TCTTCCCTGGAGTCTCTGGAAGG - Intronic
1070982301 10:80659437-80659459 TCATCCAGGCAGCCTGTGGAGGG - Intergenic
1071465278 10:85934118-85934140 TAGTGCATGCAGTCTGTGGATGG + Intronic
1071906484 10:90179999-90180021 GCATCCATGCAGACTGTGGAAGG - Intergenic
1072291144 10:93966064-93966086 ACTTCCATGCTGGCTGAGGCAGG - Intergenic
1073132661 10:101200224-101200246 CCCACCATGCATTCTGTGGAGGG + Intergenic
1073759384 10:106613379-106613401 ACTACTCTGCAGTCTGAGGAAGG + Intronic
1075950698 10:126475245-126475267 ACTTGCAGGCAGTCTAGGGAGGG + Intronic
1077445204 11:2587560-2587582 ACCTCCATGCGGTCTGAGGTCGG - Exonic
1079318495 11:19430287-19430309 TCTTCCATGGAGTATGTGGCAGG + Intronic
1080256856 11:30299854-30299876 ACTTCCTTGAAGTTTGTTGAGGG - Intergenic
1080748362 11:35129245-35129267 ACTTCCATTCAGTTGGTGGAAGG - Intergenic
1082986733 11:59175494-59175516 ACCTCTAGGCAGTCTGGGGAAGG - Intronic
1083629227 11:64087256-64087278 AGTTCCATGCCCTCTGTGCAGGG + Intronic
1085291588 11:75404111-75404133 AAATCCATGAAGTTTGTGGATGG + Exonic
1086107831 11:83166210-83166232 ACTTCCAGCCAGTCTGTGTTCGG - Exonic
1088157614 11:106827854-106827876 ACTTCCCTGCAGTCATGGGAGGG + Intronic
1088487414 11:110354161-110354183 ATTTTCATCCAGTCTGTTGAGGG - Intergenic
1088570784 11:111221694-111221716 GCTTCCGTACAGTTTGTGGAGGG + Intergenic
1088628230 11:111748605-111748627 ACTTCAGTGCAGGCTGGGGATGG + Intronic
1089596687 11:119585120-119585142 AGCTCCAGGCAGTCTGGGGAAGG - Intergenic
1092059646 12:5537961-5537983 ACCTCCACACAGGCTGTGGAGGG + Intronic
1093633500 12:21437745-21437767 ACTTCCCTGCCGTCGGGGGAGGG - Exonic
1096256272 12:50064009-50064031 ACTGCCATGCAGACAGGGGAAGG + Intronic
1101312894 12:103599741-103599763 ACCTCAGTGCAGTCTTTGGAAGG - Intronic
1102349900 12:112184554-112184576 ACCTCCATGCTGTCTGTGCCGGG + Exonic
1102863652 12:116357341-116357363 ACTCCCATGCAGTCTAAGGAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1108524056 13:51270733-51270755 ACGTCCATGTATTCTGAGGAAGG + Intronic
1109991462 13:70063290-70063312 TTATTCATGCAGTCTGTGGAGGG - Intronic
1112077900 13:95932762-95932784 CCTTCAATGCAGTTTGTTGAGGG + Intronic
1112772184 13:102803558-102803580 AATTCCATTCAGTGTGAGGAAGG + Intronic
1113756749 13:112817616-112817638 CCTTCCCTGCAGACTGTGGCTGG + Intronic
1117729035 14:58703267-58703289 ACCTCCCTGCAGCCTATGGAAGG + Intergenic
1118009203 14:61592287-61592309 ACTTCCCTGCAGCCTCTGGGAGG - Intronic
1119448544 14:74687900-74687922 ACTCCCATGCAGACTGTTCAGGG - Intronic
1120619003 14:86739718-86739740 AGGTCCATTCAGTCCGTGGAGGG + Intergenic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1127737099 15:61851954-61851976 ACTGCCATGCAGTCTAAGAAAGG + Intergenic
1128679404 15:69637040-69637062 ACTTCTTTGCTGTCTTTGGAGGG - Intergenic
1130738316 15:86572359-86572381 ACCTCCTTGCAGTCTGGGGTGGG + Intronic
1131752144 15:95521264-95521286 ACTTCAGTGCAGTTTGGGGAAGG + Intergenic
1131963867 15:97817255-97817277 ACTTCCGTGCATTCAATGGATGG + Intergenic
1132935164 16:2476152-2476174 ACTTCCAGGCAGTGTGCAGAAGG + Intronic
1133583357 16:7167521-7167543 CCTCCCATGCAGTCTTTGGAGGG + Intronic
1133901087 16:9975510-9975532 ATTTATTTGCAGTCTGTGGATGG - Intronic
1136109703 16:28057130-28057152 ACTTCCTGGCAGTCCTTGGAAGG + Intronic
1137583347 16:49648277-49648299 ATTTCCAAGCAAACTGTGGAAGG + Intronic
1138554649 16:57764437-57764459 TCTTCCCTGCAGTCTTTGGGCGG - Intronic
1139963034 16:70728789-70728811 ACTTTCAGGGAGTCAGTGGAAGG - Intronic
1141417928 16:83891132-83891154 ACTTCTATGCTGTCTGAAGAGGG - Intergenic
1141521204 16:84580790-84580812 GCTCCCATGCAGCCTGTGAATGG - Intronic
1145867251 17:28249162-28249184 ACTTCCATGGGGTCTGTGCAAGG - Intergenic
1146628915 17:34456016-34456038 ACCTCCATGCAGTGGATGGAAGG - Intergenic
1147726955 17:42571837-42571859 ACTTCCATGGAGTGGGGGGAAGG - Exonic
1149536281 17:57436006-57436028 ACTTCCATGCTGGAGGTGGAGGG + Intronic
1150522952 17:65888822-65888844 GCTTCCATGCAGCTTGTGGTTGG + Intronic
1151620119 17:75240178-75240200 TCTTCCGTGCAGTCCTTGGAGGG - Intronic
1155514914 18:26615046-26615068 AATTCCATGCAATCAGTAGAAGG + Intronic
1155553921 18:26996732-26996754 ACATACATGCACACTGTGGAGGG - Intronic
1156315213 18:35963140-35963162 AATTCCGAGAAGTCTGTGGAGGG - Intergenic
1157522321 18:48353831-48353853 ACTTCCACGCTGTGTGAGGATGG - Intronic
1157631022 18:49095865-49095887 ACTGCAATGGAGTCTGGGGAAGG - Intronic
1159505946 18:69335829-69335851 ATTTTAATGCAGTCTGTGAAGGG - Intergenic
1160139089 18:76303655-76303677 ACTGCCATTCAGTCTGTGCTGGG - Intergenic
1160213591 18:76906362-76906384 ACTTCACTGCATTTTGTGGAGGG + Intronic
1162556076 19:11386651-11386673 ACTACCCTGGAGTCTGAGGAAGG - Intronic
1163668529 19:18614094-18614116 GCTTCCACGCAGGCTGTGGGAGG - Exonic
926987861 2:18643667-18643689 GAGTCTATGCAGTCTGTGGATGG - Intergenic
928062362 2:28127479-28127501 TCTTCCAAGCAGTCTGTGAAGGG + Intronic
928861550 2:35863136-35863158 ACTTCAATGGAGTCTGCAGAAGG - Intergenic
930234412 2:48875061-48875083 ACTACCATGCAGGCTAAGGAAGG + Intergenic
932375562 2:71232689-71232711 ACTTCCTTGAAGTCTCTTGAGGG - Intergenic
932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG + Intronic
933077434 2:77946895-77946917 ACATCAATGCAGTCTGTACAAGG - Intergenic
933258051 2:80102887-80102909 ACTATGATCCAGTCTGTGGAAGG - Intronic
933450252 2:82440290-82440312 ACTGCCATGCAGTCTGCAGAAGG + Intergenic
933665959 2:84965193-84965215 ACTTCCATGAAGTCTGGAAAGGG - Intergenic
934579861 2:95429280-95429302 ACTTCCTTGCAGTCACTGAATGG + Intergenic
934599586 2:95647445-95647467 ACTTCCTTGCAGTCACTGAATGG - Intergenic
938015852 2:127866653-127866675 TCTGCCCTGCAGGCTGTGGATGG - Intronic
938505226 2:131873143-131873165 ATTTGCATGGAGTCGGTGGAGGG - Intergenic
940595242 2:155783133-155783155 AGTTCCATGAAGAATGTGGATGG - Intergenic
941406264 2:165092602-165092624 ACATCCATCCCGTATGTGGAAGG - Intronic
941716885 2:168773604-168773626 ACTACCATGCTGTCCATGGAAGG + Exonic
942017018 2:171827984-171828006 GCTTAGATGCTGTCTGTGGAGGG - Intronic
946020201 2:216635303-216635325 ACTTCCAGGCAGGCTAGGGAAGG - Intronic
948272860 2:236687565-236687587 GCTTCCATGCAGGCTGAGGAAGG - Intergenic
948660038 2:239501453-239501475 ACTTCCCTGCAGGCTGAGGTGGG + Intergenic
1170414035 20:16121068-16121090 ACTTCCATTCAGACTGAGCAGGG - Intergenic
1170926185 20:20726464-20726486 ACTTCCCTGGAATGTGTGGAAGG + Intergenic
1173981646 20:47228876-47228898 ACTTGCCGGCTGTCTGTGGATGG - Intronic
1175776282 20:61655830-61655852 ACCTGCATGCAGTCGGTGAACGG + Intronic
1176787871 21:13280736-13280758 ATTTGCATGGAGTCGGTGGAGGG + Intergenic
1177116579 21:17093356-17093378 CATTCAATGCAGTCTGTAGAGGG + Intergenic
952959320 3:38579741-38579763 CCTTCCAGGGAGTCTGGGGAGGG - Intronic
953550467 3:43898576-43898598 ACTGCCAGGCTGTCTATGGAAGG + Intergenic
953599968 3:44352841-44352863 AATTCCAAGCAGTCTGGGAAAGG - Intronic
954600350 3:51862867-51862889 ACTTCCCTGAATTCTGAGGAAGG + Intronic
959369894 3:105510240-105510262 ACTGTCATGCAGTCTAAGGAAGG + Intronic
959616829 3:108358141-108358163 ACCTACATGCACTGTGTGGATGG - Exonic
960790561 3:121425858-121425880 ACTCCAATGCAGTCTTTGTATGG - Intergenic
960965020 3:123098615-123098637 TCTTCCATGGAGAATGTGGAAGG - Intronic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
962241259 3:133753211-133753233 AGTGCAATGCAGTCTCTGGAGGG - Intronic
963600603 3:147375165-147375187 ACTTCCACACTGTCTGGGGATGG + Intergenic
966679503 3:182626481-182626503 ACTTGCATGCAGTTTGAGTATGG - Intergenic
966836987 3:184056861-184056883 ACATCCATGCTGTTTGGGGAAGG - Exonic
966848627 3:184150145-184150167 AAATCCATGAAGTTTGTGGATGG + Intronic
967103464 3:186236080-186236102 ACTTCCATGGAGCCAGTGAAGGG + Intronic
967531422 3:190553007-190553029 AATCCAATGCAGTTTGTGGAGGG + Intronic
968902835 4:3439354-3439376 CCTACCATGCTGTCTGTGCAGGG + Intronic
969065687 4:4478690-4478712 ACTGCCATGCATCATGTGGAGGG + Intronic
971050712 4:22859019-22859041 AGTTCCATGCAGGCTTTGAAGGG - Intergenic
972424474 4:38919503-38919525 AGTTCCATGCAGGCTGTGAGAGG + Intronic
973861731 4:55071771-55071793 GCCTCCATGCAGTTTGTTGAGGG + Intergenic
977337920 4:95721388-95721410 ACTGCCCTGCAGTCTAAGGAAGG + Intergenic
979378579 4:119980137-119980159 ACTTCTATACAGCCTGTAGAAGG - Intergenic
980533666 4:134087558-134087580 AGTGCAATGCAGTCTCTGGAGGG + Intergenic
981573824 4:146182546-146182568 ACTTCCATTCAGTGAGTGGTTGG - Intronic
983889804 4:173018943-173018965 ACTTCCTTGGAGGCTGAGGAAGG + Intronic
985368879 4:189263855-189263877 ACTTCCATGGAAACTATGGAGGG + Intergenic
986737402 5:10678305-10678327 ACTCCCACTGAGTCTGTGGAGGG + Intergenic
989193760 5:38695823-38695845 GCTTCCAAGCAGGCTGTGGGCGG + Intergenic
991562117 5:67964895-67964917 ACTGCAATGCAGTTTGTGAAAGG - Intergenic
992539009 5:77743513-77743535 ACTTCCCTGCAGTTTAAGGAAGG + Intronic
993448376 5:88042993-88043015 AGTTTCTTGCAGCCTGTGGAAGG - Intergenic
994264413 5:97698302-97698324 ACTTTCAGGCTGTCTGTGTAAGG + Intergenic
995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG + Intergenic
995870096 5:116735425-116735447 AGTTCGTTGCAGTCTGTGTAAGG + Intergenic
997008704 5:129850732-129850754 TCTTCCATTCAGACTCTGGAAGG - Intergenic
1001404884 5:171469226-171469248 ACCTCCAGACAGTCTGAGGAGGG + Intergenic
1002458695 5:179361552-179361574 ACTTCAATGCAGGCTGTGCTGGG - Intergenic
1003580805 6:7339105-7339127 AAATCCATGAAGTTTGTGGACGG - Intronic
1006650822 6:35549879-35549901 ACTGCCAGGCTGACTGTGGAAGG + Intergenic
1006908805 6:37550564-37550586 ACAGCCATGCAGTGTGTGAAAGG + Intergenic
1006986883 6:38181569-38181591 ACATCTCTGCAGTCTGTAGATGG - Intronic
1009875357 6:69498208-69498230 AATTCAAAGCAGTGTGTGGAGGG + Intergenic
1011246244 6:85324089-85324111 AATTCTATGCTGTGTGTGGATGG - Intergenic
1013054744 6:106572747-106572769 ATTTCCATGCACTCTCTGTAAGG - Intronic
1014218298 6:118774418-118774440 AGGTCCCTGCAGTCTCTGGAAGG - Intergenic
1019064793 6:169288003-169288025 CCTTCCATGGAGTCTCTGGAGGG - Intergenic
1019064821 6:169288113-169288135 GCTTCCATGGAGTCTCTGGAGGG - Intergenic
1019080774 6:169428093-169428115 ACTCCCATGAAGTCAGGGGAGGG + Intergenic
1019286973 7:228520-228542 ACTGCCATGGGGGCTGTGGAGGG + Exonic
1020052226 7:5089247-5089269 TCTTGCATGCAGTTGGTGGAAGG - Intergenic
1022753408 7:33257247-33257269 ATTTGCATCCAGTCTATGGATGG + Exonic
1024272701 7:47654703-47654725 ACTTCCTAGCAGTCTGTGGCTGG - Intergenic
1026338710 7:69417084-69417106 AATCCCATGGAATCTGTGGAGGG - Intergenic
1028284213 7:88975163-88975185 TTATCCATTCAGTCTGTGGATGG + Intronic
1035193561 7:157194852-157194874 ATTTCCAAGCAAGCTGTGGAAGG + Intronic
1038170959 8:25131563-25131585 ACCTCCATGCAATCTAAGGAAGG + Intergenic
1038446565 8:27608637-27608659 AGTTCCAAGCAGGCTCTGGATGG - Intronic
1040423002 8:47258471-47258493 AGATCCATGGAGTCTGGGGAGGG - Intergenic
1041492512 8:58450304-58450326 ATTTCCAAGCAAGCTGTGGAAGG - Exonic
1044188169 8:89281513-89281535 AATTTCATTCAGTCTGTTGAGGG - Intergenic
1044787317 8:95808402-95808424 TCTTCCATGCTGTCTGGGGCCGG + Intergenic
1047108501 8:121761865-121761887 TCTTCCTTACAGTCTCTGGAAGG + Intergenic
1047423172 8:124724076-124724098 ACTTCCTTGCTGTTTATGGAGGG - Intronic
1048016992 8:130506568-130506590 CTTTCCACGCAGTCTGTGGGAGG + Intergenic
1048458091 8:134596242-134596264 ACTTCCCTGCTTTCTCTGGATGG - Intronic
1048813846 8:138312710-138312732 GTTTTCATGCAGTCTGGGGATGG - Intronic
1050514222 9:6425843-6425865 ATTTCCTTGCTGTCTGTTGAAGG - Intronic
1054727551 9:68667414-68667436 TCTTCCAGGCAGCCTGTGGCAGG - Intergenic
1054796307 9:69305660-69305682 AATTCCAGACAGTTTGTGGATGG + Intergenic
1054820952 9:69520018-69520040 ACTCCCGTGAGGTCTGTGGATGG - Intronic
1055018692 9:71646117-71646139 TCTCCCATGCTGTCTCTGGAAGG + Intergenic
1055280041 9:74663795-74663817 AAGTCCAAGCAGTCTTTGGAGGG - Intronic
1056906588 9:90656024-90656046 AGTTCCAAGCAGCCTGTGGTTGG - Intergenic
1057068610 9:92076924-92076946 ACTTCCATACAGTCTGATAATGG + Intronic
1060456968 9:123807724-123807746 CATTCCATGAAGTCTGTTGAAGG - Intronic
1060719083 9:125962272-125962294 ACTTCCATGGGGTCAGAGGAAGG - Intronic
1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG + Intergenic
1186175309 X:6920420-6920442 TCTTCTGTGCATTCTGTGGAAGG + Intergenic
1187748125 X:22431930-22431952 ACTTCCATGCAAGCTTTGGCAGG - Intergenic
1187782485 X:22843506-22843528 ACTTCCATGCATTTTTTTGAGGG - Intergenic
1189906310 X:45763593-45763615 ACTTCAATGGAGGCTGTGAATGG + Intergenic
1193692059 X:84658527-84658549 AATCCAATGCAGTTTGTGGAGGG + Intergenic
1195173928 X:102296868-102296890 ATTTCCATGCAAACTCTGGAAGG + Intergenic
1195184937 X:102390225-102390247 ATTTCCATGCAAACTCTGGAAGG - Intronic