ID: 932998913

View in Genome Browser
Species Human (GRCh38)
Location 2:76896191-76896213
Sequence TTGTGTGTGTGCATAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1121
Summary {0: 1, 1: 0, 2: 7, 3: 95, 4: 1018}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932998913_932998915 14 Left 932998913 2:76896191-76896213 CCATCTCCTATGCACACACACAA 0: 1
1: 0
2: 7
3: 95
4: 1018
Right 932998915 2:76896228-76896250 AGACACACGATTTAGCCTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932998913 Original CRISPR TTGTGTGTGTGCATAGGAGA TGG (reversed) Intronic
900093157 1:929308-929330 TTCCGTGGGTGCAAAGGAGATGG + Intronic
900122045 1:1052608-1052630 GTATGTGTGTGTATAGGTGAGGG + Intronic
900177432 1:1297149-1297171 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177444 1:1297195-1297217 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177471 1:1297283-1297305 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177510 1:1297421-1297443 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177537 1:1297509-1297531 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177576 1:1297647-1297669 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177603 1:1297733-1297755 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900490251 1:2944605-2944627 TTGAGTGTGTGCATGTGAGTGGG + Intergenic
900958591 1:5904866-5904888 ATGTGTGTTTGCATAGGGGATGG + Intronic
901597470 1:10396918-10396940 TTGTGTGTGTGTGTGTGAGATGG - Intergenic
901793931 1:11669581-11669603 GTGTGTGTGTGTATATGTGAAGG - Intronic
902217602 1:14944569-14944591 TGGTGTCTGTGCATGGGAGATGG + Intronic
902511927 1:16971401-16971423 GTGTGTGTGTGCATGTGTGACGG - Intronic
902620396 1:17647385-17647407 ATGTGTGGGTGCATAGTAGGTGG + Intronic
902690715 1:18108791-18108813 ATTTCTGTGTGCACAGGAGATGG + Intronic
902744504 1:18464456-18464478 GTGTGTGTGTGCAGAGCAGAGGG - Intergenic
903223563 1:21882388-21882410 GTGTGTGTGTACATAGAAGAGGG - Intronic
903659984 1:24971008-24971030 TTGTGTGTGTGCATGTGTGTGGG + Intergenic
904429597 1:30453468-30453490 TTGAGTGGGTGCACAGGATAGGG + Intergenic
905393297 1:37651702-37651724 GTGTGTCTGTACATAGGGGAAGG + Intergenic
905592956 1:39180609-39180631 TTGTGTGTGTGCGTGTGAGGTGG - Intronic
905615118 1:39391413-39391435 ATGTGTGTGTGGAGAGGAGGAGG + Intronic
905857380 1:41322974-41322996 TTGTGTGGGTGTGTTGGAGACGG + Intergenic
905950123 1:41943561-41943583 TTGTCTGTGTGTAGAGAAGATGG - Intronic
906103029 1:43275204-43275226 ATGTGTGTGTGCATGGCAGGGGG - Intergenic
906554794 1:46701001-46701023 GTGTGTGTGTGCATGTGAGATGG + Intronic
906908151 1:49917339-49917361 ATGTGTGTCTGCACACGAGATGG - Intronic
907695960 1:56729298-56729320 TTGTGGCTGTGCATTGGGGATGG + Intronic
908536949 1:65087125-65087147 TGGTGTGTGTGCACAGAAGAAGG + Intergenic
908654089 1:66369508-66369530 TTCTGTGTGTGCTCAGGACAGGG + Intronic
909178499 1:72390140-72390162 GTGTGTCTGTGCATGTGAGATGG - Intergenic
909216374 1:72895711-72895733 GTGTGTGTGTGTATAGAAGGGGG + Intergenic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909552339 1:76912806-76912828 ATGTGTGTCTGCACATGAGATGG + Intronic
909575161 1:77167167-77167189 TTGTGTGTGTGCATAGAAATGGG - Intronic
909628423 1:77745309-77745331 GTGTGTGTCTGCACATGAGATGG + Intronic
909668357 1:78160917-78160939 TTGTGTCTTTGCACATGAGATGG - Intergenic
909863917 1:80641765-80641787 GTGTGTGTGTGTATTTGAGAGGG + Intergenic
910339147 1:86166230-86166252 GTGTGTCTCTGCATATGAGATGG + Intergenic
910510753 1:88001443-88001465 TTGTGTGTGTGGACTGGACAGGG + Intergenic
910600999 1:89032420-89032442 GTGTGTCTCTGCATGGGAGATGG + Intergenic
910737673 1:90479467-90479489 GTGTGTGTGTGGATTGGAGGGGG - Intergenic
910780797 1:90930280-90930302 TTGTGTGTGTGTGTGTGAGACGG - Intronic
910786120 1:90999791-90999813 TTGTGTCTGTGCACGTGAGATGG - Intronic
910869376 1:91818676-91818698 TTGTGTGTGTGTCTTGGAGGTGG + Intronic
911311109 1:96293091-96293113 GTGTGTGTGGGCAGTGGAGAGGG + Intergenic
911661226 1:100503676-100503698 TTGTGTGTGTGCATTGCACAGGG - Intronic
911675092 1:100649378-100649400 GTGTGTCTTTGCATATGAGATGG - Intergenic
912212738 1:107572385-107572407 TTGTGTGTGTGCGGGGGAGGTGG + Exonic
912357438 1:109066606-109066628 TTGTGTGTGGGCATGGCAGTGGG + Intronic
914689069 1:150009934-150009956 TTGTGTGTGTGTGTGAGAGAGGG - Intronic
914743562 1:150484973-150484995 GTGTGTGTGTGGTTTGGAGAAGG - Intergenic
914986683 1:152463823-152463845 GTGTGTGTGTGTGTAGGAAAGGG - Intergenic
915081609 1:153356610-153356632 CGGGCTGTGTGCATAGGAGAAGG + Intergenic
915518432 1:156427514-156427536 TTGTGTGTATGAAAAAGAGAGGG - Intronic
915527037 1:156482291-156482313 ATGTGTGTGCGCACAGGTGAGGG + Intronic
916154262 1:161828889-161828911 GTGTGTCTCTGCATATGAGATGG - Intronic
916372851 1:164118876-164118898 GTGTGTGTCTGCACATGAGATGG - Intergenic
916938769 1:169658505-169658527 GTGTGTCTTTGCATATGAGATGG - Intergenic
917009512 1:170455612-170455634 TTGTGTCTTTGCACATGAGATGG + Intergenic
917162927 1:172078509-172078531 GTGTGTCTTTGCATATGAGATGG + Intronic
917266301 1:173224205-173224227 TTGTGTTTGTGCATGGAATAGGG - Intergenic
917377787 1:174368096-174368118 TTGCGTGTGTGCATGAGAGATGG - Intronic
917423444 1:174888959-174888981 GTGTGTGTATGCATAAGATATGG + Intronic
917511380 1:175671937-175671959 GTGTGTGTGTGTGTTGGAGAGGG + Intronic
917640210 1:176976240-176976262 GTGTATGTGTGCATAGGTGGGGG - Intronic
917900562 1:179539077-179539099 GTGTGTCTTTGCACAGGAGATGG + Intronic
917980414 1:180265745-180265767 CTGTGTGCGTGCATAGGAAGGGG + Intronic
918432394 1:184475360-184475382 TTGTGTGTGTTCATTTCAGAGGG - Intronic
918524617 1:185451988-185452010 GAGTGTGTGTGAATAGGGGATGG + Intergenic
918686649 1:187425274-187425296 GTGTGTGTGTGTATAGGGAAGGG + Intergenic
918717450 1:187807828-187807850 TTGTGTCTCTGCATGTGAGATGG + Intergenic
918770810 1:188557407-188557429 GTGTGTGTGTGCATGTGAGTTGG + Intergenic
918994883 1:191744535-191744557 TTGTGTGTGTGTGTTGGAGTTGG + Intergenic
919037885 1:192339610-192339632 TTACGTCTGTGCAGAGGAGATGG - Intronic
919118285 1:193308639-193308661 GTGTGTGTGTGTGTAGGAGGAGG + Intergenic
919728565 1:200899087-200899109 ATGTGTGTGTGCAAGAGAGAGGG + Intronic
919990600 1:202706369-202706391 TTGTGTGTGTGGGCAGGAAAAGG + Intronic
920453060 1:206074906-206074928 TTGTGGGTGTGCCTGGGTGAAGG - Intronic
921314975 1:213881895-213881917 TTGTGTGTGTGCATGTGCAAGGG - Intergenic
922058827 1:222068037-222068059 TAGTCTGTGTGCCTAGAAGACGG - Intergenic
922244622 1:223783491-223783513 TTGTGTGTGTGCAAGGGGCATGG - Intronic
922820282 1:228479989-228480011 GTGTGTGTGTACATAAGAGGGGG - Intergenic
923229742 1:231974079-231974101 TAGTGTGTGAGCTTTGGAGATGG - Intronic
923284977 1:232485335-232485357 TTGAGTGTGGGGATATGAGATGG + Intronic
923332421 1:232937466-232937488 GTGTGTGTGTGCGTAGAAGTGGG + Intergenic
923374497 1:233347048-233347070 GTGTGTGTGTGTAGAGGAGCGGG + Intronic
923431494 1:233925520-233925542 ATGTGTGTCTGCACATGAGATGG + Intronic
923491856 1:234491182-234491204 GTGTGTGTGTGTAAAGGAGTGGG - Intergenic
924565496 1:245194882-245194904 GGGTGTGTGTGTGTAGGAGAGGG + Intronic
924952684 1:248898860-248898882 TTGTGTCTCTGCATGTGAGATGG - Intergenic
1062897933 10:1118742-1118764 TCGTGTGTGTGTGTAAGAGAGGG + Intronic
1063266342 10:4455271-4455293 GTGTGTGTGTGCATCTGTGATGG - Intergenic
1063374400 10:5545385-5545407 CTGTGTGTGTCCAGTGGAGAAGG + Intergenic
1063777180 10:9276761-9276783 GTGTGTGTGTGTATTTGAGATGG + Intergenic
1064274121 10:13891400-13891422 GTGTGTGTGTGCCGAGGGGAGGG + Intronic
1064450618 10:15439093-15439115 TTGTGTGTGTGTATGAGACAGGG - Intergenic
1064925923 10:20568983-20569005 GTGTGTGTCTGCATGTGAGATGG - Intergenic
1065282068 10:24149542-24149564 TTGTGTGTGTGCATCTGAAGTGG + Intronic
1065772335 10:29089010-29089032 TTGTGTGTGTGTGTGTGAGATGG - Intergenic
1067553935 10:47254596-47254618 GTGTGTGTGTGTATTAGAGAGGG - Intergenic
1068120353 10:52778151-52778173 TTGTGTATGTGCTTGGGAGAGGG + Intergenic
1068407593 10:56611000-56611022 TTGTGTGTGTGCATGTGTGTGGG - Intergenic
1069708028 10:70471323-70471345 TTGTGTGTGTGCATCTGGGTGGG + Intergenic
1069974424 10:72201152-72201174 TTGTGTGTGTGTGTATGACAGGG + Intronic
1070213794 10:74354152-74354174 TTGTGTGTAAGAATAGGAGAAGG + Intronic
1070381473 10:75884279-75884301 GTGTGTGTGTGTGTAGGGGAGGG + Intronic
1070734683 10:78855375-78855397 GTGTGTGTGTGTAAATGAGAGGG - Intergenic
1070999960 10:80820078-80820100 TTGTGTCTTTGCATGTGAGATGG - Intergenic
1071448480 10:85771576-85771598 TTGTGTCTCTGCACATGAGATGG - Intronic
1071995436 10:91143623-91143645 GTGTGTGTGTGTGTTGGAGATGG + Intergenic
1072550262 10:96471916-96471938 GTGTGTGTGTACCTACGAGAAGG + Intronic
1072859277 10:98985745-98985767 GTGTGTCTCTGCATATGAGATGG - Intronic
1072986777 10:100147673-100147695 TTGTGTGTGTGTGTAGGATGGGG - Intergenic
1073925169 10:108506632-108506654 TTGTGTCTCTGCACATGAGATGG - Intergenic
1074023274 10:109607056-109607078 GTGTGTCTGTGCATGTGAGATGG - Intergenic
1074027828 10:109654605-109654627 GTGTGTCTGTGCATGTGAGATGG - Intergenic
1074041153 10:109790545-109790567 TTATGTGTGTTCATAAGAAAAGG + Intergenic
1074180455 10:111058491-111058513 GTGTGTGTGTGCATATAAAATGG + Intergenic
1074303404 10:112253150-112253172 GTGTGTCTGTGCATGTGAGATGG - Intergenic
1074842048 10:117364077-117364099 TTGTGTGTGGGAATGGGAGAAGG + Intronic
1075412445 10:122239005-122239027 TTGTGTGTGTGTTTTTGAGACGG + Intronic
1076106301 10:127826384-127826406 TTGCTTGTGTGCATATGTGAAGG + Intergenic
1076250980 10:128983659-128983681 TTGTGTTTATGCATAGTGGAGGG + Intergenic
1077162684 11:1120924-1120946 TTGCGGGTGTGCCTAGCAGAAGG - Intergenic
1077783464 11:5357229-5357251 GTGTGTGTGTGCACATGAGATGG - Intronic
1077785162 11:5375564-5375586 GTGTGTGTGTGCACATGAGATGG - Intronic
1078506643 11:11954679-11954701 GTTTGTGTATGCATAGGAAAAGG + Intronic
1078722298 11:13896381-13896403 GTGTGTGTGTGTATCGGGGAGGG + Intergenic
1078809204 11:14741476-14741498 ATGTGTTTTTGCATATGAGATGG + Intronic
1078955581 11:16190778-16190800 TTGTGTGTGTGCGTGGCAGTGGG + Intronic
1079056363 11:17209292-17209314 AAGTGTGTGTGCATAGAGGAGGG - Intronic
1079262677 11:18898382-18898404 GTGTGTCTTTGCATATGAGATGG - Intergenic
1079683147 11:23323215-23323237 TTGTGTCTCTGCATGTGAGATGG - Intergenic
1079690550 11:23411694-23411716 TTGTGTCTTTGCATGTGAGATGG + Intergenic
1079752779 11:24219344-24219366 GTGTGTGTCTGCACATGAGATGG - Intergenic
1079853736 11:25573154-25573176 GTGTGTGTGTGAAAAAGAGAGGG + Intergenic
1079977194 11:27106343-27106365 TTGTGTCTCTGCACATGAGATGG - Intronic
1079981516 11:27156139-27156161 TTGTGTCTCTGCACATGAGATGG + Intergenic
1080042354 11:27772150-27772172 TTGTGTGTTAGGATAGGGGATGG + Intergenic
1080150742 11:29049531-29049553 GTGTGTCTCTGCATGGGAGATGG + Intergenic
1080334761 11:31182854-31182876 TTGTGTCTTTGCACATGAGATGG - Intronic
1080455058 11:32411058-32411080 GTGTGTGTGTGTATTGGAGAGGG - Intronic
1080545592 11:33314649-33314671 TTGTGTGTGTGTGTGTGAGATGG - Intronic
1081397375 11:42602683-42602705 TTGTGTGTGTCCATTGTAGGTGG - Intergenic
1081425108 11:42917811-42917833 TTGTGTCTTTGCACATGAGATGG - Intergenic
1081718190 11:45266493-45266515 GTGTGTGTGTGTATTTGAGAGGG - Intronic
1082134450 11:48531796-48531818 GTGTGTCTGTGCATGTGAGATGG + Intergenic
1082662544 11:55930175-55930197 TTGTGTGTGTGCATGTGTGTAGG + Intergenic
1082781222 11:57289016-57289038 GTGTGTGTGTGTGTTGGAGAGGG + Intergenic
1083008804 11:59374295-59374317 GTGTGTCTGTGCATGTGAGATGG - Intergenic
1083522837 11:63331970-63331992 ATGTGTCTCTGCATATGAGATGG + Intronic
1083776913 11:64898500-64898522 TTGTTTGTGAGCCTGGGAGAAGG - Intronic
1084329388 11:68421738-68421760 GTGTGTGTGTGTATGGGGGAGGG + Intronic
1084477139 11:69395499-69395521 TCGTGTGTGGGCAGGGGAGAAGG + Intergenic
1084598163 11:70129508-70129530 GTGTGTGTGTGCATGGGAGCAGG - Intronic
1084609163 11:70190772-70190794 CTGTGTGTGTGCATATGTGCCGG + Intergenic
1084609166 11:70190850-70190872 GTGTGTGTGTGCATATGTGCTGG + Intergenic
1084609170 11:70190993-70191015 GTGTGTGTGTGCATATGTGCTGG + Intergenic
1084609172 11:70191075-70191097 TAGTGTGTGTGCATATGTGCTGG + Intergenic
1084609174 11:70191159-70191181 TTGTGTGTGTGCATATGTGCTGG + Intergenic
1084609175 11:70191181-70191203 GTGTGTGTGTGCATATGTGCTGG + Intergenic
1084959909 11:72710981-72711003 TTGTGTGTGTGTGTAGAAGAGGG - Intronic
1085204003 11:74719371-74719393 GTGTGTGTGTGTACAGGGGAGGG - Intronic
1085539906 11:77257544-77257566 GTGTGTGTGTGTGTAGGAGAGGG - Intronic
1086466324 11:87057817-87057839 TTGTGTGTGTGTATAAAATAAGG + Intronic
1086565537 11:88222084-88222106 GTGTGTCTGTGCACATGAGATGG + Intergenic
1086661826 11:89428470-89428492 ATGTGTGTCTGCATGTGAGATGG - Intronic
1086722015 11:90132771-90132793 TTGTGTGTATGCATATAAGGGGG + Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087035467 11:93751842-93751864 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1087398811 11:97637835-97637857 TTGTGTGTGTGCCTGTGAGGGGG - Intergenic
1087722443 11:101682288-101682310 GTGTGTCTCTGCATATGAGATGG + Intronic
1087794478 11:102440800-102440822 ATGTGTGTCTGCACATGAGATGG - Intronic
1087924689 11:103906130-103906152 TAGTGTGTGAGCATGGGAGAGGG - Intergenic
1088738502 11:112747886-112747908 GTGTGTGTGTGTGTTGGAGAGGG + Intergenic
1088859735 11:113788596-113788618 GTGTGTGTGTGTATAGTAAAGGG - Intergenic
1089071533 11:115703506-115703528 GTGTGTGTGTGTATCTGAGATGG + Intergenic
1089193059 11:116668988-116669010 GTGTGTGTCTGCACATGAGATGG - Intergenic
1090311259 11:125743120-125743142 GTGTATGTGTGCATAGGTGTGGG - Intergenic
1090482590 11:127081284-127081306 GTGCGTGTGTGCACAGGAGGTGG + Intergenic
1090821911 11:130350235-130350257 TTGTGTGTGTGTGTTTGAGATGG + Intergenic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1091926090 12:4350906-4350928 TAGTATGTGTGGATGGGAGATGG + Intronic
1092046469 12:5434493-5434515 GTGTGTGTGTGTGTAGGGGAAGG + Intronic
1092064093 12:5575153-5575175 TTGTGGGTGCTCAGAGGAGAGGG - Intronic
1092141658 12:6188089-6188111 GTGTGTCTGTGTATAAGAGATGG - Intergenic
1092691120 12:11110906-11110928 TTGTGTCTTTGCACATGAGATGG - Intronic
1092711067 12:11338286-11338308 ATGTGTGTCTGCACATGAGATGG + Intergenic
1092805833 12:12221431-12221453 TTGTGTGTGTGTGTCAGAGAGGG - Intronic
1093085718 12:14865223-14865245 GTGTGTCTCTGCACAGGAGATGG + Intronic
1093254774 12:16853713-16853735 TTGTGTGGGAGCTAAGGAGAGGG + Intergenic
1093493736 12:19732572-19732594 GTGTGTGTCTGCACATGAGATGG + Intergenic
1093544029 12:20323872-20323894 CTGTGTGTGTGTATGAGAGAGGG + Intergenic
1093813858 12:23519543-23519565 GTGTGTGTCTGCATGTGAGATGG + Intergenic
1093997276 12:25655660-25655682 TTCTGTGAGTACAAAGGAGAGGG + Intergenic
1094755237 12:33461394-33461416 TTGTGTCTTCACATAGGAGAAGG + Intergenic
1095370202 12:41458159-41458181 TTGTGTGTGTGTATGTGAGATGG + Intronic
1095695090 12:45134716-45134738 TTGTGTCTCTGCACATGAGATGG - Intergenic
1095994121 12:48064679-48064701 GTGTGTGTGTGTATGTGAGATGG + Intronic
1096079090 12:48822112-48822134 GTGTGTGTGTGTATAGGGGAAGG - Intronic
1096216586 12:49801161-49801183 CTGTGTGTGTGTATGGGGGAGGG - Intronic
1096217567 12:49806677-49806699 TTGGGTGTGTGCAGAGGAGTGGG - Intronic
1096339696 12:50787083-50787105 GTGTGTGTGTGCGTAGGGAAGGG - Intronic
1096406095 12:51345565-51345587 TTGGGTGTGTGCCTTGAAGAGGG + Intronic
1096532271 12:52249449-52249471 GTGTGTGTGTGCATGGGAGGAGG + Intronic
1097059580 12:56272595-56272617 GTGTTTGTGTGCATGGGAGAGGG + Exonic
1097266347 12:57747527-57747549 TTCTGTGAGTGCATAGGATGGGG + Exonic
1097544006 12:60975932-60975954 TTGTGTCTCTGCACATGAGATGG + Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097906472 12:64924970-64924992 TTGTGTGTGTGAATAGAAACAGG + Intergenic
1098064153 12:66594311-66594333 TTGGGAGTGAGCACAGGAGAAGG + Intronic
1098998501 12:77149480-77149502 GTGTGTGTGTGTATTTGAGATGG + Intergenic
1099096040 12:78376184-78376206 TTGTGTGGGTGCAGAGTAGGTGG - Intergenic
1099550811 12:84041644-84041666 GTGTGTGTTTGCACATGAGATGG + Intergenic
1099797583 12:87419037-87419059 GTGTGTCTTTGCATATGAGATGG + Intergenic
1099811771 12:87592186-87592208 GTGTGTCTCTGCACAGGAGATGG + Intergenic
1099965739 12:89442857-89442879 TTGTGTCTCTGCACATGAGATGG - Intronic
1100021257 12:90072002-90072024 GTGTGTGTGTGTGTGGGAGAGGG + Intergenic
1100341284 12:93681918-93681940 TTGTGTGTGTGGGAAGGAAAGGG + Intronic
1100624627 12:96318052-96318074 GTGTGTGTCTGCATGTGAGATGG - Intronic
1100707928 12:97221653-97221675 AAATGTGTGTGCATTGGAGAAGG + Intergenic
1100983503 12:100183441-100183463 GTGTGTGTGTGCATATAAGTAGG - Intergenic
1101915853 12:108895301-108895323 ATGTGTGTGTGCATGTGTGAGGG + Intronic
1102176428 12:110878742-110878764 TTGGGTGTATGCCCAGGAGAGGG + Intronic
1102547080 12:113665034-113665056 GTCTGTGTGTGCAAGGGAGACGG - Intergenic
1102823846 12:115929655-115929677 GTGTGTGTGTGTATTAGAGACGG - Intergenic
1103263695 12:119611255-119611277 TTGTGTGGGTGCTTTGGAAATGG - Intronic
1103295958 12:119887294-119887316 GAGTGCGTGGGCATAGGAGAGGG - Intergenic
1103370324 12:120414406-120414428 TTGTGTGTGTGTCTGTGAGAGGG + Intergenic
1103557087 12:121773269-121773291 TGGTGTGTGGGCGTGGGAGAGGG + Intronic
1103653753 12:122454256-122454278 GTGTGTGTGTGTGTAAGAGATGG + Intergenic
1103830452 12:123775051-123775073 CTGTGTGTGTGCAGAGGGCATGG + Intronic
1104824536 12:131699351-131699373 TTGCGTGGGTGCTTATGAGAGGG - Intergenic
1105715583 13:23060511-23060533 TTGTGTGTGTGTGTGTGAGATGG + Intergenic
1106008509 13:25794812-25794834 GTGTGTGTGTGTGTAGGAGAGGG - Intronic
1106349505 13:28914979-28915001 GTGTGTCTTTGCATATGAGATGG + Intronic
1106360129 13:29023450-29023472 ATGTGTGTGTGCATATGAGAAGG - Intronic
1106438154 13:29741939-29741961 GTGTGTGTGTGTGTAAGAGAAGG + Intergenic
1106501382 13:30332291-30332313 GTGTGTGTGTGCATTGCACACGG + Intergenic
1107325590 13:39238923-39238945 GTGTGTGTTTGCACATGAGATGG + Intergenic
1107489580 13:40868462-40868484 GTGTGTGTCTGCACATGAGATGG + Intergenic
1107692091 13:42963619-42963641 GTGTGTGTGTGTATTGGGGAGGG + Intronic
1108342935 13:49515445-49515467 GTGTGTGTGTGTATAGGAGATGG - Intronic
1108768518 13:53665301-53665323 TTGTGTCTTTGCACATGAGATGG + Intergenic
1109097014 13:58131985-58132007 TTGTGTTTTTGCACATGAGATGG + Intergenic
1109241144 13:59890143-59890165 TTGTGTCTGTGCCTGGGAGCTGG - Intronic
1109465616 13:62728086-62728108 TTGTGTCTCTGCATGTGAGATGG + Intergenic
1110457526 13:75706592-75706614 CTGTGTGTGTGCATGGGTGTAGG - Intronic
1110821607 13:79924118-79924140 TTGTGTGTTTGCGCATGAGATGG + Intergenic
1110932936 13:81246194-81246216 TTATATGTGTGCATTGGACAAGG + Intergenic
1111273326 13:85915676-85915698 ATGTGTGTCTGCATGTGAGATGG + Intergenic
1111368207 13:87278894-87278916 GTGTGTGTGTGTATGTGAGATGG - Intergenic
1111588605 13:90313575-90313597 TTGTGAATGTGCATAGGAGCAGG + Intergenic
1111786409 13:92792641-92792663 ATGTGTGTCTGCACATGAGATGG - Intronic
1112135246 13:96570942-96570964 TTCTGTGTGTGGATGAGAGAAGG + Intronic
1112231828 13:97595461-97595483 ATGTGTGTCTGCACATGAGATGG - Intergenic
1113120765 13:106921840-106921862 TTGGGAGAGTGCATAGGATAGGG + Intergenic
1113185327 13:107680781-107680803 ATGTGTGTGTCCATGAGAGAGGG + Intronic
1113185333 13:107680876-107680898 GTGTGTGTGTCCATGAGAGAGGG + Intronic
1113590883 13:111500011-111500033 GTGTGTGTCTGCACATGAGATGG + Intergenic
1113802312 13:113092993-113093015 TGCTGTGTGTGCACAGGAGCTGG - Intronic
1114245865 14:20912831-20912853 GTGTGTGTGTGCACATGAGATGG - Intergenic
1114923276 14:27361428-27361450 GTGTGTCTGTGCATATGAGATGG + Intergenic
1114958402 14:27851183-27851205 GTGTGTCTTTGCATATGAGATGG - Intergenic
1114992613 14:28306335-28306357 GTGTGTGTGTGCATGTGTGAAGG + Intergenic
1115265623 14:31496776-31496798 TTGTGTCTTTGCACATGAGATGG - Intronic
1115344869 14:32331695-32331717 GTGTGTGTGTGTATAGGGGAAGG + Intronic
1115545684 14:34462883-34462905 GTGTGTGTGTGCATGGGTGGGGG - Intergenic
1115841296 14:37473531-37473553 CTGTGTGTGTGAATGGGAGTAGG + Intronic
1115850632 14:37587755-37587777 TTGGGAGTGAGCATAGGACAGGG - Intergenic
1116052649 14:39823915-39823937 ATGTGTGTCTGCACATGAGATGG + Intergenic
1116285900 14:42971405-42971427 GTGTGTCTCTGCATATGAGATGG + Intergenic
1116384252 14:44311154-44311176 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1116401564 14:44514075-44514097 GTGTGTGTCTGCATGTGAGATGG + Intergenic
1116417384 14:44695157-44695179 TTGTGTCTTTGCATGTGAGATGG - Intergenic
1117136642 14:52741440-52741462 GTGTGTGTGTGTATGAGAGATGG + Intronic
1117170259 14:53086899-53086921 GTGTGTGTCTGCATGTGAGATGG - Intronic
1117417477 14:55510495-55510517 GTGTGTGTGTGTGTAGGGGATGG - Intergenic
1117796824 14:59403596-59403618 GTGTGTCTCTGCATATGAGATGG + Intergenic
1117811698 14:59553718-59553740 GTGTGTCTCTGCATATGAGATGG - Intronic
1117889877 14:60408340-60408362 GTGTGTCTGTGCACATGAGACGG + Intronic
1117936394 14:60912209-60912231 GTGTGTCTGTGCACATGAGATGG + Intronic
1118023234 14:61741019-61741041 TTATGTATGTGGGTAGGAGATGG - Exonic
1118038202 14:61890784-61890806 TTCTGTGAGTGAATGGGAGAGGG + Intergenic
1118058339 14:62106772-62106794 TTGTCTGTGTGTCTAGGATATGG - Exonic
1118379416 14:65205358-65205380 TTGCTTGTGTGCTCAGGAGATGG + Intergenic
1118521108 14:66586275-66586297 ATGTGTGTCTGCATGTGAGATGG + Intronic
1118569398 14:67177953-67177975 TTGTGTCTTTGCATGTGAGATGG + Intronic
1118855239 14:69615993-69616015 TTGTGTATGTGTGTAGGAGCGGG - Intronic
1119153065 14:72383230-72383252 GTATGTGTGTGGATGGGAGAGGG + Intronic
1120065974 14:80041053-80041075 TTGTGTCTTTGCATATGAGATGG - Intergenic
1120121595 14:80686680-80686702 GTGTGTCTTTGCATATGAGATGG - Intronic
1120142135 14:80941421-80941443 TGGAGTGTGTGCAGAGGTGAGGG - Intronic
1120323845 14:83000732-83000754 ATGTGTATGTGCATTGGAAAAGG - Intergenic
1120811719 14:88810602-88810624 GTGTGTGTGTGCATATGGAAGGG - Intergenic
1121545991 14:94764029-94764051 TTGTGTGTGTGTGTTGGTGAGGG - Intergenic
1121674571 14:95741889-95741911 GTGTGTGTGTGTGTTGGAGAGGG + Intergenic
1121793702 14:96718589-96718611 TTGTGTATGTTCCTGGGAGAGGG + Intergenic
1123975210 15:25547067-25547089 TTGGGTGAGTGCCTAGGAGTTGG + Intergenic
1124669073 15:31621653-31621675 TTGTGTCTCTGCATGTGAGATGG + Intronic
1124907886 15:33888754-33888776 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1125334061 15:38610411-38610433 GTGTGTGTGTGTGTAGGAGTGGG + Intergenic
1125363671 15:38890921-38890943 ATGTGTGTGTGCATATGCGGTGG + Intergenic
1125825457 15:42672636-42672658 TTGTGTGTTTGCAGAGAGGAGGG + Intronic
1126071468 15:44868383-44868405 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1126720305 15:51571039-51571061 ATGTGTGTCTGCATGTGAGATGG - Intronic
1126961456 15:54001290-54001312 GTGTTTGTATGCATTGGAGAAGG + Intergenic
1127373956 15:58365146-58365168 GTGTGTCTTTGCATATGAGATGG - Intronic
1127660022 15:61091801-61091823 TTGTGTGTATTCATAGGCAAGGG + Intronic
1128039886 15:64562899-64562921 GTGTGTGTGTGTCTAGGAGAGGG + Intronic
1128284847 15:66428312-66428334 GTGTGTGTGTGTGTATGAGAGGG + Intronic
1128479554 15:68025473-68025495 GTGTGTGTGTGTATACGACAGGG - Intergenic
1128711572 15:69876123-69876145 GTGTGTGTGTGCATGGGGGTTGG - Intergenic
1129081953 15:73049096-73049118 TTGTGTGTGGGGGTGGGAGAAGG - Intergenic
1129219897 15:74126076-74126098 GTGTGTGTGTGCAAAGGGGGTGG + Intronic
1130067319 15:80615571-80615593 TGGTGTGTGTGAATATGTGAAGG + Intergenic
1130966713 15:88702973-88702995 CTGAGTGTGTGCTTAAGAGAGGG - Intergenic
1131081190 15:89537438-89537460 TTGTGTGTGTGCAAATGACCAGG + Intergenic
1131087731 15:89591127-89591149 TTGTGTGTGTGTGTGTGAGACGG + Intronic
1131345898 15:91647812-91647834 GTGTGTTTGTGGAAAGGAGAAGG + Intergenic
1132026110 15:98405703-98405725 GTGTGTGTGTGTATGAGAGAGGG - Intergenic
1132442639 15:101884111-101884133 TTGTGTCTGTGCACGTGAGATGG + Intergenic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1133389543 16:5398490-5398512 TTGTGGGTGTGCATGTGAGCAGG + Intergenic
1133678505 16:8098433-8098455 TTGTAGGTGTGCATTTGAGATGG - Intergenic
1134196825 16:12165732-12165754 TTTTGTGTGTTCAGTGGAGACGG + Intronic
1134286413 16:12865826-12865848 TCATGAGTGTGCATATGAGACGG - Intergenic
1134555570 16:15160963-15160985 TTGTGTGTGTTTTGAGGAGAAGG + Intergenic
1134680975 16:16125311-16125333 AAATGTGTGTGCTTAGGAGATGG + Intronic
1135512283 16:23096096-23096118 TTGTGTCTCTGCACATGAGATGG - Intronic
1135608481 16:23843950-23843972 GTGTGTGTGTGCATGTGTGATGG - Intronic
1136040313 16:27573524-27573546 ATGTGTGTGTGCACAGAGGAAGG + Intronic
1136098098 16:27973467-27973489 AAGAGTGTGTGCTTAGGAGATGG + Intronic
1136645554 16:31610872-31610894 ATGTGTCTTTGCATATGAGATGG - Intergenic
1137497172 16:48979481-48979503 TTGTGTGTGTGTTTGGGTGAGGG + Intergenic
1137615023 16:49841275-49841297 TTGTGCCTGGGGATAGGAGAAGG - Intronic
1137712392 16:50575422-50575444 TTGTCTGTGTTCCTGGGAGAAGG + Intronic
1137802733 16:51275913-51275935 TTGTGTGTCTGTATAGGATTGGG - Intergenic
1138093669 16:54195759-54195781 TTGTGTGTGTGCAAAGGGTGGGG + Intergenic
1138330150 16:56207002-56207024 TTGTATGTGCCCATGGGAGATGG + Intronic
1139562006 16:67749053-67749075 TTGTGTACGTGAATAGGCGAGGG + Intronic
1141415351 16:83867602-83867624 GTGTGTCTTTGCATATGAGATGG + Intergenic
1141861943 16:86723328-86723350 TTGTGTGTGTGCATGCGTGCAGG + Intergenic
1141978030 16:87531125-87531147 TTCTGTGTCAGCATAGGATAAGG + Intergenic
1142363844 16:89639528-89639550 GTGTGTGTGTGCAGAGGTGGGGG - Intergenic
1142491863 17:284692-284714 TTGGCTGTGTGCATAGGGGAAGG - Intronic
1142922962 17:3207316-3207338 CTGCGTTTGTGCAAAGGAGAGGG + Intergenic
1143203227 17:5126473-5126495 TTGTATGTGTGGTTAGGTGACGG + Intronic
1143470993 17:7175337-7175359 TTGTGTGTGTGTGTGGGTGAAGG - Intronic
1143989490 17:10944588-10944610 GTGTGTGTGTGCACAGAAGAGGG + Intergenic
1144249551 17:13401788-13401810 TTGTATCTCTACATAGGAGACGG + Intergenic
1145290531 17:21542125-21542147 TCATGTGTGTGTATGGGAGAAGG - Intronic
1146173832 17:30652123-30652145 GGGTGTGTGTGCATCAGAGAAGG - Intergenic
1146347288 17:32068144-32068166 GGGTGTGTGTGCATCAGAGAAGG - Intergenic
1146586452 17:34086927-34086949 GTGTGTCTCTGCATGGGAGATGG + Intronic
1146923812 17:36730657-36730679 GTGGGTGTGTGCATAGGGGAGGG + Intergenic
1147177009 17:38662233-38662255 GTGTGCATGTGCATAGGAGCAGG + Intergenic
1147585510 17:41651976-41651998 TTGTGTGTGTGCATGTGTGTTGG - Intergenic
1148098296 17:45070255-45070277 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1148185734 17:45642455-45642477 GTGTGTGTGTGTTTTGGAGATGG + Intergenic
1148232606 17:45945917-45945939 TTACATGTGTGCATAGGAGAGGG + Intronic
1149013504 17:51882444-51882466 TTGTGTGTGTGTATGGGTGTTGG + Intronic
1149351976 17:55799461-55799483 GTGTGTGTTTGCACATGAGATGG + Intronic
1150546018 17:66157632-66157654 TTGTGTCTTTGCATGTGAGATGG - Intronic
1151194023 17:72419207-72419229 TTGTGGGTCTGAATGGGAGATGG + Intergenic
1151358536 17:73574533-73574555 TTGTGTGTGAGTGCAGGAGATGG + Intronic
1152287225 17:79420120-79420142 GTGTGTGTGTGTGTATGAGACGG - Intronic
1152582015 17:81170100-81170122 TTGTGTGTCTGCATATGTGTAGG + Intergenic
1153026640 18:678905-678927 CTGTGTATCTGCAGAGGAGAAGG + Intronic
1153576404 18:6526208-6526230 GTGTGTGTGTGTACATGAGAAGG - Intronic
1153631413 18:7073838-7073860 GTGTGTGTGTGTTTATGAGAAGG + Intronic
1154045547 18:10901405-10901427 GTGTGTGTGTGAATAGAAGTAGG - Intronic
1155066165 18:22270911-22270933 TTTTGTGTGTGCCAAGGAGTTGG + Intergenic
1155351575 18:24912615-24912637 TTTTGTCTGTGAAGAGGAGATGG - Intergenic
1155727893 18:29112447-29112469 TTGTGTGTTTGTATAGGCCAGGG + Intergenic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156709566 18:39926504-39926526 ATGTGTGTCTGCACATGAGATGG - Intergenic
1156848234 18:41694881-41694903 TTGTGTGGGTAAAGAGGAGATGG - Intergenic
1157058037 18:44254152-44254174 TTGTGTCTTTGCACATGAGATGG + Intergenic
1157631868 18:49106293-49106315 TTGTGTCTCTGCATGTGAGATGG + Intronic
1157632693 18:49114679-49114701 GTGTGTGTGTGTTTAAGAGATGG + Intronic
1157679990 18:49597581-49597603 GTGTGTGTGTGCAGAGGGAAAGG + Exonic
1157981997 18:52392618-52392640 ATGTGTGTGTGTGTAGGTGAGGG + Intronic
1158109148 18:53920630-53920652 ATGTGTGTGTGCATGGGGGCGGG + Intergenic
1158109169 18:53920793-53920815 GTGTGTGTGTGCATGGGGGCGGG + Intergenic
1158178682 18:54687216-54687238 TCCTGTGTGTGTCTAGGAGATGG + Intergenic
1158409234 18:57189850-57189872 TTGTGTGTGTGCAGAGGTGAAGG + Intergenic
1158676760 18:59527383-59527405 ATGTGTCTTTGCACAGGAGATGG + Intronic
1158703912 18:59773563-59773585 GTGTGTCTCTGCATACGAGAAGG - Intergenic
1158839726 18:61372072-61372094 TTGTGTGAGTGAAAAGTAGAAGG - Intronic
1158948508 18:62469083-62469105 TTGTGTGTGTGTGTGTGAGATGG + Intergenic
1159100361 18:63950884-63950906 TTGTTTTTGTGAATAGGAGATGG + Intronic
1159136193 18:64339565-64339587 TTGTGAGTTTGCAAAAGAGAAGG + Intergenic
1159202395 18:65204269-65204291 GTGTGTGTGTGTATTTGAGATGG + Intergenic
1159271681 18:66161072-66161094 GCGTGTGTGTGCACAAGAGAGGG - Intergenic
1159462355 18:68737524-68737546 TTGTGTGTGTGTGTATGTGAAGG + Intronic
1159592124 18:70346830-70346852 GTGTGTCTGTGCATGTGAGATGG + Intronic
1159793087 18:72808458-72808480 GTGTGTGTGTGGTGAGGAGATGG + Intronic
1159979161 18:74755238-74755260 TTGTGTCTCTGCACATGAGATGG + Intronic
1160260451 18:77289235-77289257 TTGTGTCTCTGCACATGAGATGG + Intergenic
1161118409 19:2512077-2512099 TTGTGTGTGTGCGTGGGTGGGGG + Exonic
1161556226 19:4944322-4944344 TTGTGTCTGTGCCTGGGACAGGG + Exonic
1161839355 19:6669729-6669751 GTGTGTGTGTGTGTAGGACAGGG - Intronic
1162105019 19:8364852-8364874 GTGTGTGTGTGTAGAAGAGACGG - Intronic
1162114964 19:8423504-8423526 TTGTGTGTGTACTTGGGGGAGGG + Intronic
1162223869 19:9203459-9203481 TTGTGTGTGTGTGTAAGACAAGG + Intergenic
1162988585 19:14287918-14287940 GGGTGTGTGTGCATCAGAGAAGG + Intergenic
1163523617 19:17807134-17807156 GTGTGTGTGTGTATTGGAGCAGG + Intronic
1164416832 19:28052937-28052959 TTGTGTCTTTGCATGTGAGATGG - Intergenic
1165083236 19:33323445-33323467 TTGTGTGTGGACATATGATATGG - Intergenic
1165106584 19:33473406-33473428 CTCTCTGTGTGCACAGGAGATGG - Intronic
1165220885 19:34315869-34315891 TTGTGTGTGTGCAAGGGAATAGG + Intronic
1165723106 19:38093614-38093636 GTGTGTGTGTGGATATGAGAAGG - Intronic
1165756643 19:38297133-38297155 TTGTGTGTTTGCATGTGGGAAGG + Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166888642 19:45976287-45976309 TTGTGTGTGTCCAAACGGGAGGG - Intergenic
1167136477 19:47619252-47619274 TTGTGTGTGTGTGTTTGAGATGG + Intronic
1167454772 19:49592270-49592292 TTGTGTGTGTGTAAGGGAGGGGG + Intronic
1168210441 19:54886241-54886263 TTGTGTGTGTGTGTGTGAGATGG - Intronic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
925160158 2:1677928-1677950 GTGTGTGTGTGCAGCGGAGATGG + Intronic
925363456 2:3295420-3295442 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363602 2:3296128-3296150 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925515781 2:4679372-4679394 TTGTGTGTGTGTATGGGTGTGGG - Intergenic
925523997 2:4779601-4779623 TTGTGTGTGTGTATGAAAGATGG - Intergenic
926015573 2:9448560-9448582 TTGTGTGTGTGTGTGTGAGACGG + Intronic
926150334 2:10422376-10422398 TGGTGGGTGTACAGAGGAGACGG - Intronic
927271177 2:21212465-21212487 TTGTGTCTCTGCATGTGAGATGG + Intergenic
927334560 2:21907208-21907230 GTGTGTGTCTGCACATGAGATGG + Intergenic
927530052 2:23788647-23788669 TTGTGTGTGTGTATATGTGTAGG - Exonic
927748205 2:25642217-25642239 GTGTGTGTGTTGATAGGAGAAGG + Intronic
928044231 2:27911390-27911412 TTGTATGTAAGCAAAGGAGAAGG + Intronic
928196260 2:29218683-29218705 TTGTATGCATGCAAAGGAGAGGG - Intronic
928292319 2:30050352-30050374 TGGTCTGAGTGCATAGGGGATGG + Intergenic
928349331 2:30534263-30534285 GTGTGTGTGTGTTTGGGAGACGG + Intronic
929257511 2:39828865-39828887 ATGTGTCTTTGCATATGAGATGG + Intergenic
929461014 2:42101971-42101993 TTGCGAGTGGGCAGAGGAGAGGG + Intergenic
929545666 2:42854104-42854126 ATGTGTGTGAGTATGGGAGATGG + Intergenic
930359562 2:50360362-50360384 ATGTGTCTGTGTATATGAGATGG - Intronic
930433917 2:51316600-51316622 GTGTGTGTCTGCATTTGAGATGG + Intergenic
930471097 2:51814840-51814862 TTGTGTGGGTGGGTGGGAGAGGG + Intergenic
930483956 2:51988546-51988568 TTGTGTGTTTGCTGAGGAGTAGG - Intergenic
931201983 2:60106327-60106349 TTGCGTGTGTGCAAAGGTGGGGG - Intergenic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
931643560 2:64401885-64401907 GTGTGTGTGTGTATAAGAGAAGG + Intergenic
931839884 2:66137046-66137068 GTGTGTGTGTGTGTCGGAGACGG + Intergenic
931977280 2:67656332-67656354 GTGTGTGTCTGCATGTGAGATGG - Intergenic
931978813 2:67672052-67672074 GTGTGTGTGTGAATATGAGGTGG - Intergenic
931978816 2:67672107-67672129 TTGTGTGTGTGTATGTGAGGTGG - Intergenic
932662475 2:73668386-73668408 ATGTGTCTGTGCACATGAGATGG + Intergenic
932961898 2:76422115-76422137 GTGTGTGTGTGTATACAAGAAGG - Intergenic
932998913 2:76896191-76896213 TTGTGTGTGTGCATAGGAGATGG - Intronic
933672753 2:85024741-85024763 TTTTTTGTGTGTATAGGATATGG + Intronic
933986752 2:87598305-87598327 ATGTGTGTATACATAGGACAAGG - Intergenic
934316293 2:91923291-91923313 GTGTGTCTCTGCATATGAGATGG - Intergenic
934478895 2:94616861-94616883 GTGTGTCTTTGCATATGAGATGG + Intergenic
935010714 2:99133473-99133495 GTGTGTCTTTGCATATGAGATGG + Intronic
935168394 2:100589819-100589841 CTGTCTGTGTGCCTTGGAGAAGG + Intergenic
935631033 2:105212229-105212251 GTGTGTCTCTGCATATGAGATGG + Intergenic
936055869 2:109261535-109261557 TTGTGTTTGTCCCTGGGAGATGG - Intronic
936307091 2:111352504-111352526 ATGTGTGTATACATAGGACAAGG + Intergenic
936530542 2:113273631-113273653 TTGTGTGTGTGACTTGGGGAGGG - Intronic
936806223 2:116335688-116335710 GTGTGTCTGTGCACATGAGATGG + Intergenic
936945382 2:117925375-117925397 GTGTGTCTCTGCATATGAGATGG - Intronic
937215912 2:120313537-120313559 TTGTGTGTGCGCCAAGAAGAAGG + Intergenic
937234112 2:120420016-120420038 ATGTGTGTGTGGATAGGTGGAGG - Intergenic
938192223 2:129294094-129294116 GTGTGTGTCTGCATGTGAGATGG - Intergenic
938199869 2:129363744-129363766 GTGCGTGTGTGCATGCGAGAGGG - Intergenic
939115234 2:138053195-138053217 GTGTGTGTGTGTGTAGGAGAAGG + Intergenic
939321442 2:140628355-140628377 TTGTGTGTTTTTATTGGAGACGG - Intronic
939479472 2:142730099-142730121 TTGTGTCTCTGCATGTGAGATGG - Intergenic
939519139 2:143207465-143207487 GTGTGTGTGTCAATGGGAGAGGG - Intronic
939681835 2:145145607-145145629 GTGTGTGTGTGTATTGGGGATGG - Intergenic
939795938 2:146644070-146644092 GTGTGTCTCTGCACAGGAGATGG - Intergenic
939937530 2:148311536-148311558 GTGTGTGTTTGCATGTGAGATGG + Intronic
940005948 2:149009828-149009850 TTGGGTGTGTGTAGAGGAAAGGG - Intronic
940475047 2:154151818-154151840 GTGTGTGTCTGCATGTGAGATGG + Intronic
940736109 2:157454147-157454169 GTGTGTGTGTGTGTAGCAGAAGG + Intronic
940954714 2:159714416-159714438 TTCTGTGGGAGCATAGGGGAGGG + Intronic
941574401 2:167212902-167212924 GTGTGTGTGTGCAGAGGGGTGGG - Intronic
941803052 2:169682475-169682497 GTGTGTGTGTGTATAGAAAATGG - Intronic
942195057 2:173508875-173508897 GTGTGTGTGTGTGTAGGAAAGGG - Intergenic
942280108 2:174353470-174353492 TTGTGTGTGTGTGTGTGAGATGG + Intronic
943084766 2:183298702-183298724 ATGTGTCTTTGCATATGAGAAGG + Intergenic
943213274 2:184996878-184996900 TGGTGTGTGTGTATGGGAGCAGG - Intergenic
943479572 2:188400953-188400975 GTGTGTGTGTGTGTAAGAGAGGG + Intronic
943514269 2:188864502-188864524 TTGTGTCTTTGCACATGAGATGG - Intergenic
943975088 2:194465690-194465712 GTGTGTGTGTGCATATCAGTTGG + Intergenic
944169202 2:196756512-196756534 TTGTGTCTTTGCACATGAGATGG + Intronic
944418014 2:199498108-199498130 TTGTGTGTGTGCATGTGACAGGG + Intergenic
944905313 2:204256369-204256391 GTGTGTGTGTGAAAAAGAGATGG + Intergenic
944972907 2:205014470-205014492 CAGTGTGTGTGCCGAGGAGAAGG + Intronic
944983757 2:205151664-205151686 TTGTGTCTCTGCATGTGAGATGG + Intronic
945045390 2:205777004-205777026 TTGTGTGTGTGTTTGGGCGAGGG + Intronic
945171694 2:207003015-207003037 GTGTGTCTGTGCATGTGAGATGG - Intergenic
945392699 2:209283971-209283993 GTGTGTCTCTGCATGGGAGATGG + Intergenic
945957368 2:216098822-216098844 GTGTGTGTGTGGATAGGCGTGGG + Intronic
946110354 2:217409447-217409469 TTGTGTGTGAGGATAGGAGATGG - Intronic
946188986 2:217997234-217997256 CTGAGTGTGATCATAGGAGAAGG - Intronic
946423217 2:219576747-219576769 GTGTGTGTGTGTTTAGGGGAAGG + Intergenic
946658509 2:221975157-221975179 TTGTGTGTATGTAGAGGGGAAGG - Intergenic
947350349 2:229236967-229236989 GTATGTGTGTGTAAAGGAGAAGG - Intronic
947654330 2:231813409-231813431 TTGTGTGTGTGTGTGTGAGACGG + Intergenic
947731035 2:232431806-232431828 TTGTGTGTATGCACAGGGGGCGG - Intergenic
949029919 2:241789313-241789335 CTGTGTGTGTGTATAGTTGAAGG + Intronic
1170161659 20:13319731-13319753 GTGTGTGTGTGCAGGGGGGAGGG - Intergenic
1170163052 20:13335313-13335335 GTGTGTGTGTGCATAGGTGAGGG - Intergenic
1170428482 20:16258048-16258070 AGGTGTGTGTGCATGGGATAGGG - Intergenic
1170635648 20:18101794-18101816 TCGTGTGTGTGTTTGGGAGATGG + Intergenic
1170784790 20:19458172-19458194 GTGTGTGTGTGCATGTGAGGGGG - Intronic
1170886129 20:20341040-20341062 TTGTGTGTGCGCACAGGGGAAGG - Intronic
1171394899 20:24825801-24825823 TAGTGTGTGGGCTTAGGAGCCGG - Intergenic
1171555417 20:26078502-26078524 GTGTGTGTGTGTATTCGAGATGG - Intergenic
1171736492 20:28792149-28792171 TTGTGTCTCTGCACATGAGATGG + Intergenic
1171763495 20:29234578-29234600 GTGTGTCTCTGCATATGAGATGG - Intergenic
1172438101 20:34944497-34944519 ATGTGTGGGTGAATATGAGAAGG - Intronic
1172578207 20:36026036-36026058 TTGTGTGTGTGTGTGAGAGATGG + Intronic
1172920405 20:38476546-38476568 GTCTGTGTGTGCATGGGATAGGG + Intronic
1173032541 20:39375670-39375692 GTGTGTGTGTGTAGAGGAGGAGG + Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173771584 20:45664309-45664331 GTGTGTCTGTGCACATGAGATGG + Intronic
1173921942 20:46752881-46752903 TTTTGAGTGTGTACAGGAGATGG + Intergenic
1173941715 20:46916489-46916511 ATGTGTGTGTGCATGTGTGATGG + Intronic
1173992569 20:47314647-47314669 ATGTGTATGTGTTTAGGAGATGG + Intronic
1174390078 20:50213633-50213655 TTGTGTGTGTGCATGCAAGAGGG + Intergenic
1174620426 20:51870165-51870187 GTATGTGTGTGTATAGAAGAAGG + Intergenic
1174736765 20:52972439-52972461 GTGTGTGTGTGCATATGTGGGGG + Exonic
1174854715 20:54032578-54032600 GTGTGTCACTGCATAGGAGATGG - Intronic
1175366098 20:58457231-58457253 TTGTGTGTGTGAGAAGGAGCAGG + Intergenic
1176002544 20:62839518-62839540 ATGTGTGTGTCCAGATGAGAAGG + Intronic
1176285019 21:5014791-5014813 TTGTGGGTGTGCAAGGGAGGTGG - Intergenic
1176660981 21:9634738-9634760 CTGTGTGTGTGCAGCAGAGAAGG + Intergenic
1176819186 21:13640552-13640574 TTGTGTGTGTGTATTCTAGATGG + Intronic
1177133403 21:17283998-17284020 GTGTGTGTTTGCATTTGAGATGG - Intergenic
1177436210 21:21056514-21056536 GTGTGTGTGTGCATGAGAGAGGG + Intronic
1177912061 21:27045074-27045096 GTGTGTGTGTGTGTAGGATAAGG + Intergenic
1178180707 21:30157879-30157901 TTGTGAGTGTAAATAGGAAAGGG + Intergenic
1178725464 21:35047506-35047528 GTGTGTGTGTGTGTTGGAGATGG - Intronic
1179246634 21:39638902-39638924 TGGAGTGTGTGACTAGGAGAGGG + Intronic
1179872162 21:44248684-44248706 TTGTGGGTGTGCAAGGGAGGTGG + Intronic
1179982653 21:44904367-44904389 TTGTGTGTGTGCATATATGTGGG - Intronic
1180122767 21:45765065-45765087 TGGTGTGTGTGCAGAGGGCATGG + Intronic
1180524042 22:16237289-16237311 TTGTGTCTCTGCATGTGAGATGG - Intergenic
1180579957 22:16824748-16824770 TTCTGTGAGTCCAAAGGAGAAGG - Intergenic
1180735584 22:18014106-18014128 GTGTGTGTGTGTCTAAGAGAGGG - Intronic
1180755627 22:18159058-18159080 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1180907054 22:19421674-19421696 GTGTGTGTGTGTGTATGAGATGG + Intronic
1181005527 22:20011658-20011680 GTGTGTGTGTGCACCTGAGATGG + Intronic
1181749967 22:24982551-24982573 TTGTGGGTCTGCATGGGTGAGGG + Intronic
1182063704 22:27415896-27415918 GTGTGTGTGTGCATGTGAAAAGG - Intergenic
1182080199 22:27523400-27523422 TTGGGTGTTTGCCTAGGAGCAGG - Intergenic
1182169401 22:28211386-28211408 GTGTGTGTCTGCATGTGAGATGG - Intronic
1182793686 22:32974652-32974674 GTGTGTGTGTGCATGTAAGAGGG + Intronic
1182948818 22:34352001-34352023 TTGTGTGTGTGCATGTGTGTTGG + Intergenic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184024748 22:41846903-41846925 TTCTCTGTGAGCATGGGAGATGG + Intronic
1184173317 22:42772226-42772248 CTCTGTGTGTGCAGAGGGGAAGG - Intergenic
1184284401 22:43460836-43460858 CTGTGCGTGTGCCTAGGAAAGGG - Intronic
1184490162 22:44803740-44803762 GGGGGTGTGTGCATGGGAGAGGG - Intronic
1184515221 22:44957652-44957674 TGGTGTGTTTGCACAGGAAAGGG - Intronic
1185265671 22:49901604-49901626 TTGTGTGTGTGCATGCGTGGTGG + Exonic
949450232 3:4176792-4176814 GTGTGTCTTTGCATATGAGATGG - Intronic
949706244 3:6820724-6820746 TTGTGTGTGTGTCTTGGAGGAGG - Intronic
950189467 3:10966628-10966650 TTGTGTGTGGGGATAGCAGGGGG - Intergenic
950619469 3:14192665-14192687 GTGTGTGTTTGCATGTGAGATGG + Intronic
951038655 3:17963715-17963737 CTGTGTGTGTGGATTGGACATGG + Intronic
951154915 3:19339948-19339970 TTCTGTGTGTGGAAAGAAGAGGG + Intronic
951175486 3:19594150-19594172 TTGTGTGTGTGCACGTGAGATGG + Intergenic
951324231 3:21283628-21283650 GTGTGTGTTTGCACATGAGATGG + Intergenic
951361039 3:21724403-21724425 GTGTGTCTTTGCATATGAGATGG - Intronic
951439778 3:22709151-22709173 GTGTGTGTCTGCACATGAGATGG - Intergenic
951783244 3:26388628-26388650 GTGTGTCTCTGCATATGAGATGG + Intergenic
951999897 3:28773089-28773111 TAGTGTGTGTGTATCGGGGATGG - Intergenic
952023839 3:29055502-29055524 GTGTGTGTTTGCACATGAGATGG + Intergenic
952384435 3:32829660-32829682 GCGTGTGTGTGCATTGGAGGAGG + Intronic
952517487 3:34120457-34120479 TAGTGTCTGTGCATGTGAGATGG + Intergenic
952966507 3:38624198-38624220 GTGTGTGTGTGTAAGGGAGAAGG - Intronic
953555001 3:43938326-43938348 GTGTGTCTTTGCATATGAGACGG + Intergenic
954346411 3:50003430-50003452 GTGTGTGTGTGCCTCTGAGAAGG + Intronic
954548351 3:51458167-51458189 GTGTGTGTCTGCATGTGAGATGG - Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954614914 3:51964558-51964580 TTGGGAGTGGGAATAGGAGAAGG - Intronic
955090586 3:55746637-55746659 TTGTGCTTCTGCAAAGGAGAAGG + Intronic
955115934 3:56001764-56001786 TTGGGTGTGTGCATGACAGATGG - Intronic
955264353 3:57427160-57427182 GTGTGTGTGTGTGTAGGAGATGG + Intronic
955458815 3:59156898-59156920 TTGTGTGAGAGCTTAGGTGAAGG - Intergenic
955468334 3:59259412-59259434 TTGTGTGTGAGAAAAGGAGCAGG - Intergenic
955837727 3:63076004-63076026 GTGTGTGTGTGTGTAGGAGGTGG + Intergenic
955937508 3:64115454-64115476 GTGTGTGTCTGCATGGGAGATGG - Intronic
956155505 3:66292187-66292209 TTGTGTCTTTGCACATGAGATGG + Intronic
956220303 3:66895261-66895283 TTGTGTCTTTGCACATGAGATGG - Intergenic
956439526 3:69266331-69266353 TTTTGTGTGTGCGTGTGAGATGG + Intronic
956610497 3:71117534-71117556 GTGTTTGTGTGTATGGGAGAGGG + Intronic
956884424 3:73544948-73544970 ATGTGTGCATGCATTGGAGATGG - Intronic
956993501 3:74796461-74796483 GTGTGTCTCTGCATATGAGATGG - Intergenic
957008844 3:74982568-74982590 TTGTGTCTTTGCACATGAGATGG + Intergenic
957619803 3:82581080-82581102 ATGTGTGTGTGGACAGGTGAGGG - Intergenic
957930711 3:86875054-86875076 TTGTGTCTTTGCATGTGAGATGG + Intergenic
958253149 3:91293373-91293395 TTGTGTCTCTGCACATGAGATGG - Intergenic
958255276 3:91318519-91318541 GTGTGTCTTTGCACAGGAGATGG + Intergenic
958257231 3:91339284-91339306 GTGTGTCTTTGCATATGAGATGG + Intergenic
958523692 3:95225066-95225088 GTGTGTCTTTGCATATGAGATGG + Intergenic
958564790 3:95796140-95796162 GTGTGTGTGTGTGTAGGAGACGG - Intergenic
958574599 3:95931923-95931945 TTTTGTGTGTGCGTGTGAGAGGG - Intergenic
959328927 3:104977051-104977073 TTCTGAGTGTGGATAGGAGAAGG + Intergenic
959534835 3:107472617-107472639 GTGTGTCTTTGCATATGAGATGG - Intergenic
959907643 3:111728413-111728435 TTGTGTGTGTGTAGGTGAGAGGG + Intronic
960319904 3:116221865-116221887 GTGTGTGTGTGTGTAGGTGAGGG + Intronic
960751961 3:120965167-120965189 GTGTGTCTTTGCATATGAGATGG + Intronic
961587315 3:127943193-127943215 TTGTGTGTATACACAGAAGAGGG + Intronic
961667121 3:128499358-128499380 GTATGTGTGTGCGGAGGAGATGG - Intergenic
961930830 3:130531005-130531027 GTGTGTGTGTGTAGAGGAGGGGG - Intergenic
962168791 3:133078783-133078805 ATGTGTGTGTGCATCAGAGAGGG - Intronic
962221654 3:133569438-133569460 GTGTGTCTGTGTCTAGGAGAAGG + Intergenic
962498228 3:135964575-135964597 GTGTGTGTGTGTATAGCACAAGG - Intergenic
962833950 3:139170359-139170381 GTGTGTGTCTGCATGTGAGATGG + Intronic
962925884 3:139993090-139993112 TTGTGTGTGTGTATGGGAGGGGG + Intronic
963676251 3:148315335-148315357 TTCTGCTTGTGAATAGGAGAGGG + Intergenic
963686786 3:148445332-148445354 TTGTGTGTGTGCATAAGTGGAGG - Intergenic
963722441 3:148877916-148877938 ATGTGTGTGTGTTTTGGAGAAGG + Intronic
964046270 3:152331177-152331199 ATGTGTGTGTGTGTAGGGGAAGG - Intronic
964150131 3:153514466-153514488 TTGTGTGTATGCAAAAGGGATGG - Intergenic
964202760 3:154136878-154136900 TTTTGTGTGTGTATAAGATATGG + Intronic
964377796 3:156067049-156067071 GTGTGTCTTTGCATATGAGATGG + Intronic
964877020 3:161378902-161378924 GTGTGTGTGTGTATTTGAGATGG + Intergenic
964959239 3:162403766-162403788 GTGTGTGTGTGTATTCGAGATGG + Intergenic
965223784 3:165961107-165961129 GTGTGTGTCTGCATGTGAGATGG - Intergenic
965497489 3:169415634-169415656 GTGTGTCTTTGCATATGAGATGG - Intronic
966255372 3:177910715-177910737 TTGTGTCTTTGCACATGAGATGG - Intergenic
966912635 3:184568124-184568146 GTGTGTTTGTGCATGGGTGAGGG + Intronic
967105349 3:186251091-186251113 GTGTGTGTGTGCATGGCAGTGGG + Intronic
967995041 3:195160136-195160158 TTGTTTCTGGGGATAGGAGAAGG - Intronic
968869240 4:3233147-3233169 GTCTGTGTGTGCCTAGGACAAGG + Exonic
969245330 4:5928339-5928361 GTGTGTGTGTGTGTATGAGAGGG - Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
970032018 4:11686575-11686597 TTGTGTCAGTAAATAGGAGAAGG + Intergenic
970102320 4:12538733-12538755 TTGTGTGTGTGCACATGGGTGGG + Intergenic
970260058 4:14215172-14215194 TTGTGTGTGTGTTTGGGATAGGG - Intergenic
970598315 4:17619772-17619794 ATCTGTGTTTGCATATGAGATGG - Intronic
970678848 4:18484233-18484255 TTGTGTGTGTGCATGTGAAGGGG - Intergenic
970735734 4:19165267-19165289 GTGTGTGTGTGCATGCGTGAAGG - Intergenic
970893577 4:21075527-21075549 GTGTGTCTGTGCATATGAGATGG + Intronic
970964663 4:21914316-21914338 TTGGATGTGTGCATAGGGGTGGG + Intronic
971150879 4:24030299-24030321 TTGTGTTAGAGCATAGGAGTGGG - Intergenic
971600346 4:28583327-28583349 GTGTATGTGTGCATATGAGTGGG - Intergenic
972249255 4:37281989-37282011 TTGTGTATGTACAGAAGAGATGG - Intronic
972675150 4:41253038-41253060 TTGTGTGTGTGTTTGGGGGATGG - Intergenic
972972571 4:44595325-44595347 GTGTGTCTGTGCACATGAGATGG - Intergenic
973009521 4:45053796-45053818 TTGTGTCTCTGCATGTGAGATGG - Intergenic
973273231 4:48282169-48282191 GTGTGTCTGTGCATGTGAGATGG - Intergenic
973341630 4:49011363-49011385 ATGTGTGTGTGCATGCAAGATGG + Intronic
973602874 4:52559390-52559412 TTCTGTGTGTTCATAGGATATGG + Intergenic
973730663 4:53819283-53819305 GTGTGTGTGTGTTTTGGAGATGG - Intronic
974023882 4:56714867-56714889 GTGTGTCTCTGCATATGAGATGG - Intergenic
974114711 4:57566208-57566230 TTGTGTCTCTGCACATGAGATGG + Intergenic
974160155 4:58128446-58128468 TTGTGTGTGAGCATGGGATATGG + Intergenic
974427368 4:61758567-61758589 GTGTGTCTCTGCATAAGAGATGG + Intronic
974865017 4:67569732-67569754 TTGTGTGTGTGTGTGTGAGATGG + Intronic
975207069 4:71656832-71656854 TTGTGTGTGTGAAAAGGAGGAGG + Intergenic
975212772 4:71720637-71720659 TTGTGTCTTTGCATGTGAGATGG + Intergenic
975309084 4:72882639-72882661 CTGTGTCTCTGCATATGAGATGG + Intergenic
975364766 4:73516719-73516741 TTGTGTCTCTGCACATGAGATGG + Intergenic
975744426 4:77462485-77462507 GTGTGTCTGTGCACATGAGATGG + Intergenic
975977735 4:80117829-80117851 GTGTGTTTATGCATATGAGATGG - Intronic
976123806 4:81811554-81811576 GTGTGTGTGTGTTTAAGAGATGG - Intronic
976170685 4:82301431-82301453 TTGTGTCTCTGCACATGAGATGG + Intergenic
976354460 4:84100657-84100679 GTATGTGTGTGTGTAGGAGAGGG + Intergenic
976378804 4:84376125-84376147 TTGTGTATTTGCACAGCAGATGG - Intergenic
976451160 4:85192890-85192912 GTGTGTCTTTGCATATGAGATGG + Intergenic
976506262 4:85851336-85851358 GTGTGTGTCTGCACATGAGATGG + Intronic
976506979 4:85859154-85859176 GTGTGTGTGTGCACAGAAGTGGG - Intronic
977044103 4:92047623-92047645 GTGTGTGTGTGTATATGAGAGGG - Intergenic
977065772 4:92313111-92313133 GTGTGTGTGTGTATATGAGATGG + Intronic
977154710 4:93557343-93557365 ATGTGTGTCTGCATGGGAGACGG - Intronic
977425776 4:96865120-96865142 GTGTGTCTTTGCATATGAGATGG - Intergenic
977455821 4:97258485-97258507 GTGTGTCTGTGCACATGAGATGG + Intronic
977481339 4:97580562-97580584 TTGTGTGTGTGTGTGTGAGAGGG - Intronic
977653384 4:99494367-99494389 GTGTGTGTTTGCATGTGAGATGG - Intergenic
977897204 4:102378641-102378663 GTGTGTCTCTGCATGGGAGATGG + Intronic
977925998 4:102701247-102701269 GTGTGTCTCTGCATGGGAGATGG + Intronic
978050083 4:104188063-104188085 TTGTGGGTGTGTATTAGAGAGGG + Intergenic
978059940 4:104325357-104325379 GTGTGTCTCTGCATGGGAGATGG + Intergenic
978203086 4:106046041-106046063 GTGTGTGTGTGTATAGGAAGTGG - Exonic
978328120 4:107581444-107581466 GTGTGTCTTTGCATATGAGATGG - Intergenic
978636090 4:110809027-110809049 TTGTGTATGTGCACATGGGATGG + Intergenic
978753138 4:112274621-112274643 TTGTGTGTGTGTATATGTGGTGG - Exonic
979115497 4:116817314-116817336 GTGTGTCTTTGCATATGAGATGG - Intergenic
979373000 4:119911755-119911777 TGCTGTGGGAGCATAGGAGATGG - Intergenic
979487700 4:121287040-121287062 TTGTGTCTCTGCATGTGAGATGG - Intergenic
979775661 4:124585330-124585352 ATGTGTGTCTGCACATGAGATGG - Intergenic
980119708 4:128715178-128715200 GTGTGTGTGTGTATTGGAGGTGG - Intergenic
980336103 4:131475460-131475482 GTGTGTCTTTGCATGGGAGATGG - Intergenic
980459554 4:133090021-133090043 TTGTGTGTCTACATAGAAGTTGG + Intergenic
981222725 4:142255458-142255480 GTGTGTGTCTGCATGTGAGATGG - Intronic
981313671 4:143320819-143320841 TTGGGTGTGTGTATGGGCGAGGG - Intergenic
981909916 4:149967235-149967257 TTGTGTGTGTGCATAGAGGGCGG - Intergenic
982184711 4:152783934-152783956 TGGTGTGTGTGTATATGAGGAGG + Intronic
982576587 4:157118929-157118951 TTGTGTGTGTGTGTAGGTAATGG + Intronic
982960773 4:161833769-161833791 GTGTGTCTCTGCATGGGAGATGG + Intronic
983167541 4:164496507-164496529 TTGTCTGTGTTCACTGGAGAAGG + Intergenic
983224304 4:165071883-165071905 TTGTGTGTGTGCATGGGGCTGGG + Intergenic
983606514 4:169592520-169592542 TTGTGTGTGTGCACTGAGGAAGG + Intronic
985624705 5:979159-979181 GTGTGTGTGTGCATGGGTGTGGG - Intergenic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
986626664 5:9729172-9729194 GTGTGTGTGTGCTTAGCAGGGGG + Intergenic
987292583 5:16522660-16522682 TTGTGTATGTCCATAGAAGAGGG - Intronic
987809235 5:22812365-22812387 ATATGTGTTTGCAGAGGAGACGG - Intronic
987973315 5:24978895-24978917 TTGTGTCTCTGCATGTGAGATGG - Intergenic
987997348 5:25301800-25301822 GTGTGTGTGTGTGTAGGAAAAGG + Intergenic
988023496 5:25654074-25654096 TTGTGTCTCTGCATGTGAGATGG + Intergenic
988145551 5:27301533-27301555 GTGTGTGTGTGCATACGCCATGG - Intergenic
988401243 5:30763136-30763158 GTGTGTGTGTGCATATGGTATGG + Intergenic
988836928 5:35042760-35042782 GTGTGTGTGTGTGTAAGAGATGG + Intronic
988849973 5:35171461-35171483 TCCTGTGTGAGCATAGGTGATGG + Intronic
989569716 5:42933968-42933990 TTGTGTCTCTGCATGTGAGATGG - Intergenic
989616637 5:43343010-43343032 GTGTGTCTCTGCATATGAGATGG - Intergenic
989682247 5:44043170-44043192 GTGTGTCTGTGCATGTGAGATGG - Intergenic
990163916 5:52974497-52974519 GTGTGTGTCTGCATGTGAGATGG + Intergenic
990466985 5:56079896-56079918 ATGTGTGTGAGTATAGGAGGGGG + Intergenic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
991000487 5:61777788-61777810 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
991044804 5:62211428-62211450 GTGTGTGTTTGTATGGGAGAGGG - Intergenic
991089073 5:62676688-62676710 ATGTGTGTCTGCACATGAGATGG + Intergenic
991496124 5:67228068-67228090 GTGTGTCTCTGCATATGAGATGG + Intergenic
991934979 5:71792320-71792342 GTGTGTGTTTGCATGTGAGATGG - Intergenic
991946951 5:71907312-71907334 GTGTGTGTATGCATAAGGGAAGG + Intergenic
992134933 5:73734814-73734836 TTGTGTTTTTGCAGTGGAGAGGG + Intronic
992231157 5:74665424-74665446 GTGTGTGTGTGTGTAGGAGGAGG + Intronic
992281812 5:75185550-75185572 TTGTGTGTGTGTGTGTGAGATGG - Intronic
992303832 5:75413658-75413680 GTGTGTGTGTGTATAGGTGTTGG - Intronic
992634722 5:78716504-78716526 TTGTGTGTGTGGATGGGGGGTGG + Intronic
993119376 5:83755707-83755729 TTGTGTCTTTGCACATGAGATGG - Intergenic
993134875 5:83947395-83947417 GTGTGTGTGTGCAGAGGTGCTGG + Intronic
993244496 5:85433697-85433719 ATGTGTGTCTGCACATGAGATGG - Intergenic
993294317 5:86114911-86114933 GTGTGTGTGTGTGTATGAGAAGG - Intergenic
993305263 5:86268925-86268947 GTGTGTCTCTGCATATGAGATGG + Intergenic
994072461 5:95618552-95618574 TGATGTGTGTGCATAGAAAAAGG + Intergenic
994587477 5:101728099-101728121 TAGTGTCTGTGCATAGGGGAAGG - Intergenic
994721348 5:103384076-103384098 GTGTGTCTTTGCATATGAGATGG + Intergenic
995112076 5:108439434-108439456 GTGTGTCTGTGCACATGAGATGG - Intergenic
995471438 5:112505834-112505856 TTGTGTCTTTGCACATGAGATGG - Intergenic
995501411 5:112811018-112811040 TTGTGTGTGTGTGTGTGAGATGG - Intronic
995660665 5:114479151-114479173 GTGTGTGTCTGCACATGAGAGGG - Intronic
995679385 5:114700039-114700061 TTGTGAGAGTGCATATGGGAAGG - Intergenic
995785685 5:115825056-115825078 GTGTGTCTTTGCATGGGAGATGG + Intergenic
995896818 5:117022738-117022760 TTGTGTGTGTGTTTAGGGGTGGG + Intergenic
996028053 5:118672774-118672796 TTTTGTGTGTGCACTTGAGAAGG + Intergenic
996112232 5:119579542-119579564 TTTTGTGTCTCCATTGGAGAAGG - Intronic
996357578 5:122613756-122613778 GTATGCGTGTGCATAGGAAAGGG - Intergenic
996526706 5:124488131-124488153 CTGTGTGTTTGCACATGAGATGG + Intergenic
996645273 5:125807265-125807287 GTGTGTGTGTGTATGAGAGATGG - Intergenic
996773187 5:127106990-127107012 TTGTGTCTCTGCACATGAGATGG + Intergenic
996964218 5:129289115-129289137 GTGTGTGTCTGCACATGAGATGG + Intergenic
997400485 5:133598215-133598237 TTGTGTGTGTGCATGCGAGGAGG + Intronic
997418585 5:133748564-133748586 TTGTGTGTGTGTGTGTGAGATGG - Intergenic
997620959 5:135294602-135294624 GTGTGTGTGTGTATGAGAGAGGG + Intronic
997797637 5:136826910-136826932 GTGTGTCTCTGCATATGAGATGG + Intergenic
997838298 5:137214983-137215005 GTGTGTGTATGCTTAGGACATGG - Intronic
997879922 5:137580413-137580435 ATGTGTGTGTTCATGGGAAAAGG - Intronic
998052897 5:139051185-139051207 GTGTGTGTGTTCAAGGGAGAGGG - Intronic
998150560 5:139754952-139754974 GTGTGTGTGTGCAGTGGAGAGGG + Intergenic
998659954 5:144225190-144225212 TGGGGTGTGTGGATGGGAGAAGG + Intronic
998794208 5:145800293-145800315 GTGTGTGTGTGTGTAAGAGAAGG - Intronic
999127364 5:149255702-149255724 TTGTGTTTGAACATAGCAGAAGG + Intronic
999415608 5:151393290-151393312 GTGTGTGTCTGCACATGAGATGG + Intergenic
999811276 5:155129790-155129812 ATGGGGGTGTGCATAGGAAAGGG - Intergenic
999842451 5:155443475-155443497 GTGTGTGTGTGCTAGGGAGATGG + Intergenic
1000234613 5:159345827-159345849 TTGTGTGTGTTCAGAGGTGAGGG + Intergenic
1000444452 5:161302641-161302663 TTGTGTGTGGGTAGAGGAGATGG + Intronic
1000832005 5:166114021-166114043 TTGTGTGTGTGCATGGCAGGTGG + Intergenic
1000907001 5:166976071-166976093 GTGTGTGTGTGTGTAAGAGAGGG + Intergenic
1001086453 5:168703266-168703288 GTGTGTGTGTGTGTAGGACATGG + Intronic
1001428840 5:171643830-171643852 ATGTGTGTGAGCATGTGAGAGGG + Intergenic
1001702745 5:173719289-173719311 GTGTGTGTGTGTGTAGGTGATGG + Intergenic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1002686037 5:181010285-181010307 GTGTGTCTTTGCATATGAGATGG - Intergenic
1003151652 6:3556992-3557014 GTGTGTGTGTGTGTAGGAAATGG + Intergenic
1003666967 6:8120442-8120464 TTTTGTGTGTGTGTAGGGGAGGG + Intergenic
1004127043 6:12883903-12883925 GTGTGTGTGTGCATGTGAGTGGG - Intronic
1004767720 6:18749654-18749676 GTGTGTGTGTGTGTATGAGAGGG - Intergenic
1005127665 6:22466813-22466835 TTGACTGTGTGCTTAGGAAAGGG + Intergenic
1005364138 6:25060505-25060527 GTGTGTGTGTGGAAAGGGGAGGG + Intergenic
1006201410 6:32295329-32295351 TTGTGTGTGTGTGTGTGAGATGG - Intronic
1007081073 6:39104706-39104728 TTGAGTGTGTACAAAGGGGAGGG - Exonic
1007254272 6:40517653-40517675 CTGTGTATGTGCATTGCAGAAGG + Intronic
1007285227 6:40742786-40742808 ATGTGAGTGTGCATTGGGGAAGG - Intergenic
1007613305 6:43164785-43164807 GTGTGTGTGTGTGTAAGAGATGG - Intergenic
1007858374 6:44881144-44881166 TTGTGTCTTTGCACATGAGATGG - Intronic
1007860426 6:44902277-44902299 GTGTGTCTGTGCACATGAGATGG - Intronic
1008032289 6:46710411-46710433 CTGTGTGTGCGCATTGGGGAGGG + Intronic
1008082913 6:47212307-47212329 GTGTGTCTTTGCATATGAGATGG - Intergenic
1008088767 6:47271768-47271790 GTGTGTGTGTGCGTGTGAGATGG - Intronic
1008729017 6:54457416-54457438 TTGTGTCTCTGCACATGAGATGG + Intergenic
1008963455 6:57290055-57290077 GTGTGTGTTTGCATGTGAGACGG - Intergenic
1009186569 6:60581080-60581102 GTGTGTCTTTGCATATGAGATGG - Intergenic
1009191340 6:60633676-60633698 TTGTGTCTTTGCACATGAGATGG + Intergenic
1009341100 6:62555826-62555848 GTGTGTCTGTGCACATGAGATGG - Intergenic
1009402910 6:63277458-63277480 GTGAGTGTGTGCATATGAGTGGG - Intronic
1009930325 6:70169805-70169827 TTGTGTGTATGAGTATGAGAGGG - Intronic
1010207972 6:73339828-73339850 TTGTGTGTGTGTGTAGGGGTAGG - Intergenic
1010375234 6:75161060-75161082 GTGTGTGTGTGCCTAGGATGGGG - Intronic
1010461216 6:76116646-76116668 ATGTGTGTCTGCACATGAGATGG + Intergenic
1010668082 6:78653709-78653731 GTGTGTCTTTGCATATGAGATGG + Intergenic
1010833153 6:80555333-80555355 GTGTTAGTGTGCAGAGGAGAGGG + Intergenic
1010869049 6:81015951-81015973 TTGTGTCTCTGCACATGAGATGG + Intergenic
1010907993 6:81516745-81516767 GTGTGTGTGTGTGTAGGAGTGGG - Intronic
1010994237 6:82514515-82514537 ATGTGTGTTTGCATGTGAGATGG - Intergenic
1011019010 6:82789662-82789684 TTCTGTTTGTGGAAAGGAGATGG + Intergenic
1011130749 6:84049774-84049796 TTGCTTATGTGCACAGGAGAAGG + Intronic
1011377420 6:86704877-86704899 TTGTGTCTTTGCATGTGAGATGG + Intergenic
1011703385 6:89976513-89976535 TTGTGTGTGTGGGCAGGAAAAGG + Intronic
1011807202 6:91085777-91085799 TTGTGTGTGAGCATAGAGGTAGG + Intergenic
1011815905 6:91190119-91190141 ATGTGTCTTTGCATATGAGATGG + Intergenic
1011877639 6:91980806-91980828 TTGTGTGTCTGTATGGGAAAGGG - Intergenic
1011916259 6:92510372-92510394 TTGTGTCTTTGCATGTGAGATGG - Intergenic
1011921246 6:92579458-92579480 GTGTGTCTTTGCATATGAGATGG - Intergenic
1012498140 6:99857385-99857407 TTGTGTCTCTGCACATGAGATGG - Intergenic
1012612442 6:101232214-101232236 GTGTGTGTGTGCATGGTGGAGGG - Intergenic
1012922178 6:105231890-105231912 ATGTGTCTTTGCACAGGAGATGG + Intergenic
1013083009 6:106829334-106829356 ATGTGTGTGTACATGTGAGAGGG + Intergenic
1013696643 6:112710220-112710242 ATGTGTGTGTGTATTGGAGGGGG + Intergenic
1013935748 6:115590890-115590912 TTGTGTATGTGCATGTGTGAAGG - Intergenic
1014043111 6:116851906-116851928 GTGTGTCTTTGCATATGAGATGG - Intergenic
1014128266 6:117802580-117802602 GTGTGTCTCTGCATATGAGATGG + Intergenic
1014384949 6:120788668-120788690 GTGTGTGTGTGGGCAGGAGAGGG - Intergenic
1014606000 6:123474196-123474218 GTGTGTCTCTGCATATGAGATGG - Intronic
1014757044 6:125312880-125312902 CTGTGTGTGTGCATGTTAGAGGG - Intergenic
1014967950 6:127780285-127780307 ATGTGTCTCTGCACAGGAGATGG + Intronic
1015332456 6:131996815-131996837 ATGTAGGTGTGCATAGGTGAGGG - Intergenic
1015893033 6:137988054-137988076 TTGTGTCTCTGCACATGAGATGG + Intergenic
1015931492 6:138364919-138364941 GTGTGTGTCTGCATGTGAGATGG - Intergenic
1016190904 6:141262878-141262900 TTCTGTATGTGCATAGGAAGAGG - Intergenic
1016338312 6:143033256-143033278 TTGTGTCTTTGCACACGAGATGG + Intergenic
1016662847 6:146600913-146600935 GTGTGTGTGCGCATGGGGGAGGG - Intronic
1016764298 6:147774872-147774894 GTGTGTGTGTGAAGAGGAGGTGG - Intergenic
1016862466 6:148734606-148734628 ATGTGTGTGTGTGTTGGAGATGG - Intergenic
1016959413 6:149657197-149657219 TTGTGTATGTGAAGAGTAGAGGG - Intergenic
1017660135 6:156665755-156665777 GTGTGTCTCTGCATATGAGATGG - Intergenic
1018163692 6:161073768-161073790 TTGTGTGTGTGTATTGCGGAGGG + Intronic
1018507621 6:164488841-164488863 ATGTGTGTCTGCACATGAGATGG + Intergenic
1018652262 6:166002385-166002407 TTGTTTGGGTGCAGAGGGGAAGG - Intergenic
1018766131 6:166934320-166934342 TTGTGTGTGTGCTAAGGGGTGGG - Intronic
1019004366 6:168784100-168784122 TTGTGTGTGTGTGTGTGAGACGG + Intergenic
1019106489 6:169671749-169671771 TTGTGAGTGTGCAGAGGAGAAGG - Intronic
1019639623 7:2096530-2096552 TTCTGTGTGTGCATTGGGCAGGG + Intronic
1020773939 7:12430221-12430243 GTGTGTCTCTGCATATGAGATGG + Intergenic
1020983565 7:15103233-15103255 TTGTGTGTATGCGTAGGTGTGGG - Intergenic
1021163490 7:17304913-17304935 ATGTGTGTTTGCGTAGAAGAAGG + Intronic
1021249549 7:18307137-18307159 GTGTGTGTTTGTATAGGAGGAGG + Intronic
1021511318 7:21435905-21435927 TTGTTTGTTTGCATTTGAGATGG + Intronic
1021805934 7:24354864-24354886 TTGTGTCTTTGCATGTGAGATGG - Intergenic
1021957894 7:25844589-25844611 TTGTGTGTGTACAGATGAGATGG + Intergenic
1022180663 7:27916030-27916052 TTGTGTGTGTGCACAGGGGTGGG + Intronic
1022520854 7:31006091-31006113 CTGTGTGTTCCCATAGGAGAGGG + Intergenic
1022549069 7:31219747-31219769 GTGTGTGTGTGTGTATGAGATGG - Intergenic
1023039723 7:36161526-36161548 CCGTGTGTGTGCATGGGGGAGGG - Intronic
1023081587 7:36531866-36531888 GTGTGCGTGTGCACAGGGGAGGG + Intronic
1023097004 7:36671675-36671697 TTGCCTGTGTGTATAGGAGTGGG + Intronic
1023519243 7:41034253-41034275 ATGAGTGTGTGCAAGGGAGAAGG + Intergenic
1023711464 7:42997702-42997724 TTTTGTGTGTACATATGAGTGGG - Intergenic
1024193662 7:47037701-47037723 GTGTGTGTGTGCATATGTGTGGG + Intergenic
1024248199 7:47486179-47486201 TTGTGAGTTTGCATATGAGTGGG + Intronic
1024519559 7:50292983-50293005 TTGTGTTTGTGCATATCTGAGGG + Intergenic
1024838188 7:53549460-53549482 TAGGGTGTGTGCTTAGGAGTAGG + Intergenic
1024855442 7:53773173-53773195 TTGAGGGTGTGCATAGGACTTGG - Intergenic
1024943591 7:54786395-54786417 GTGTGTGTGTGGTTAGGACATGG + Intergenic
1025281864 7:57632329-57632351 GTGTGTGTGTGTATTTGAGATGG + Intergenic
1025302865 7:57833188-57833210 GTGTGTGTGTGTATTTGAGATGG - Intergenic
1025791814 7:64695044-64695066 GTGTGTGTGTGCACAGAATATGG - Intronic
1026260459 7:68750695-68750717 GTGTGTGTGTGCATATGTGTGGG + Intergenic
1026422080 7:70250196-70250218 GCATGTTTGTGCATAGGAGATGG - Intronic
1026527222 7:71164699-71164721 GTGTGTGTGTGCATGTGACAAGG + Intronic
1026796472 7:73369112-73369134 GTGTGTGTGTGAAGAGGGGATGG - Intergenic
1027178335 7:75919401-75919423 GTGTGTGTATGCATATAAGAGGG + Intronic
1027360529 7:77403914-77403936 TTGTGTGTGTATCTAGGAGTGGG - Intronic
1027910514 7:84244476-84244498 GTGTGTCTGTGCACATGAGATGG + Intronic
1028523872 7:91761311-91761333 TTGTGTCTTTGCATGTGAGATGG - Intronic
1028982212 7:96979731-96979753 TTGTGTGTTGGCCTGGGAGAGGG - Intergenic
1029057610 7:97762663-97762685 GTGTGTGTCTGCACATGAGATGG - Intergenic
1029099458 7:98116450-98116472 GTGTGTGTGTGTGAAGGAGAGGG + Intronic
1029373483 7:100164254-100164276 GTGTGTGTGTGCATGTAAGAGGG - Intronic
1029383919 7:100231219-100231241 GTGTGTGTGTGTGCAGGAGAGGG - Intronic
1029617602 7:101669052-101669074 GTGTGTGTGTGTTTAAGAGATGG + Intergenic
1029649052 7:101878315-101878337 CAGTGAGTGTGCCTAGGAGAGGG + Intronic
1030497545 7:110318302-110318324 TTGAGTGTTTGTATTGGAGATGG - Intergenic
1031128361 7:117801741-117801763 ATGTATGTGTGTAAAGGAGAAGG + Intronic
1031144051 7:117978229-117978251 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
1031157291 7:118124474-118124496 TTGTGTCTCTGCACATGAGATGG - Intergenic
1031321928 7:120341011-120341033 TTGTATTTGTGCATAAGGGAAGG + Intronic
1032021887 7:128411361-128411383 GTGTGTATGTGCATAGGAAGAGG - Intergenic
1033013036 7:137642960-137642982 GTGTGTGTGTGTATGGGGGATGG + Intronic
1033106875 7:138535103-138535125 GTGTGTCTCTGCATATGAGATGG + Intronic
1033499784 7:141936376-141936398 AAGTGTATGTGCATGGGAGAGGG + Intronic
1033642499 7:143275486-143275508 TTGTATATGTGTATAGGATATGG - Intergenic
1033771470 7:144557392-144557414 TAGTGTGTGTGGAGAGCAGAAGG - Intronic
1033976961 7:147114697-147114719 GTGTGTGTTTGCATGTGAGATGG + Intronic
1034068678 7:148161540-148161562 TTGTGTGTGTGTATGGGAGGTGG - Intronic
1034636846 7:152574491-152574513 TTTTGTGTGTGTGTGGGAGAGGG + Intergenic
1034721465 7:153298054-153298076 GTGTGTGTGTGTATAAGAGAAGG + Intergenic
1035380299 7:158434925-158434947 TTGTGTGTGTGTATGGTATAAGG - Intronic
1035470309 7:159105107-159105129 TTGTGTGTGTCCTTAGCAGATGG + Intronic
1035491918 7:159286776-159286798 GTGTGTCTTTGCATATGAGATGG - Intergenic
1035962468 8:4152708-4152730 TTGTGTGTGTGTATATGTAAAGG - Intronic
1036190273 8:6663760-6663782 ATGTGTGTGTGTATGGGAGGTGG + Intergenic
1036542556 8:9731597-9731619 TTGTGTGTGTGCTGTGGCGATGG + Intronic
1037585133 8:20270833-20270855 TTGTGTGTGTGGAGAGGGAAGGG + Intronic
1037674253 8:21040872-21040894 GTGTGTGTGTGCATGAGAGAGGG - Intergenic
1037817115 8:22118176-22118198 GTGTGTGTGTGCCTTGGCGAGGG + Intronic
1038590439 8:28832504-28832526 ATGTGTGTGTGCATAAGAGGTGG + Intronic
1038901003 8:31843801-31843823 ATGTGTGTGTGAATAGGCTATGG + Intronic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039287781 8:36061365-36061387 TTGTGTGTGTGGGCAGGGGATGG + Intergenic
1039418681 8:37417831-37417853 TTGTGTGTATGCAGTGGGGAGGG - Intergenic
1039636892 8:39177383-39177405 ATGTGTCTTTGCATGGGAGATGG + Intronic
1039639432 8:39203519-39203541 GTGTGTCTCTGCATGGGAGATGG + Intronic
1040368353 8:46743771-46743793 TTGTGTCTCTGCACATGAGATGG + Intergenic
1040400883 8:47048199-47048221 TTGTGTCTTTGCACATGAGATGG - Intergenic
1040426273 8:47290041-47290063 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1040451519 8:47552648-47552670 TTGTGTCTCTGCATGTGAGATGG + Intronic
1040686474 8:49879010-49879032 TTGTGTCTCTGCATGTGAGATGG + Intergenic
1040885637 8:52260695-52260717 GTGTGTATGTGTATAGAAGAAGG - Intronic
1041027165 8:53699045-53699067 GTGTGTCTCTGCATGGGAGATGG + Intergenic
1041750507 8:61255486-61255508 ATGTGTGTGTGGAGAGGTGAAGG + Intronic
1041751666 8:61267422-61267444 ATGTGTGTATGTATTGGAGATGG - Intronic
1041776661 8:61530014-61530036 GTATGTGTGTGCAGAAGAGAGGG + Intronic
1041837522 8:62233154-62233176 CTGTGTGTTTGCATAGCAGAAGG + Intergenic
1041898951 8:62959456-62959478 GTGTGTGTGTGTGTAGGAGTTGG + Intronic
1042019333 8:64354085-64354107 GTGTGTGTCTGCATAGGGGGAGG - Intergenic
1042079841 8:65039478-65039500 GTGTGTGTGTGTGTAAGAGATGG - Intergenic
1042492208 8:69412433-69412455 TTGTAAGTTTGCAGAGGAGAGGG - Intergenic
1042603824 8:70526365-70526387 GTGTGTGTCTGCGTATGAGAGGG + Intergenic
1043410095 8:79984528-79984550 GTGTGTCTGTGCACATGAGATGG - Intronic
1043440974 8:80276830-80276852 GTGTGTGTGTGTATGTGAGATGG - Intergenic
1043602832 8:81961837-81961859 GCATGTGTGTACATAGGAGAAGG + Intergenic
1043870093 8:85422734-85422756 GTGTGTCTCTGCACAGGAGATGG + Intronic
1044225211 8:89710427-89710449 GTGTGTGTCTGCATGTGAGATGG - Intergenic
1044610434 8:94086785-94086807 TTGTGTCTTTGCATGTGAGATGG + Intergenic
1044646436 8:94448453-94448475 TTGGGTGTGTGCCAAGAAGAGGG - Intronic
1044776829 8:95698751-95698773 TTGTGTGTGTGTTTGGGGGAGGG - Intergenic
1044866499 8:96576068-96576090 TTGTGTGTGGGGATCGGGGAGGG - Intronic
1044960568 8:97526916-97526938 TTGTGTCTCTGCACATGAGATGG + Intergenic
1045293639 8:100854557-100854579 GTGTGTGTCTGCATGTGAGATGG - Intergenic
1046036750 8:108852112-108852134 ATGTGTGTGTGCCTGTGAGAAGG + Intergenic
1046045523 8:108959699-108959721 TTGTGTGTGTGCATATAGGAGGG + Intergenic
1046135383 8:110018871-110018893 ATGTGTGTGGGCATAGGTGCTGG + Intergenic
1046346328 8:112932680-112932702 GTGTGTGTGTGCGTGGGAGGGGG + Intronic
1046583441 8:116122331-116122353 GTGTGTGTGTGTGTAAGAGAAGG + Intergenic
1046617685 8:116495627-116495649 TTTTGTCTGTGCATGGGATACGG - Intergenic
1046832427 8:118761298-118761320 TTGTGTGTGTCCACATGGGATGG - Intergenic
1046915160 8:119671991-119672013 CTGTGTGTGTGCGTGGGAGGGGG + Intronic
1047702570 8:127464253-127464275 GTGTGTGTGTGTGTAGGAGAAGG - Intergenic
1048345859 8:133573690-133573712 TTGCTTGTGTGCATGGGAGGAGG + Intergenic
1048467277 8:134676184-134676206 TTGTGTGTTTGCACATGAAATGG - Intronic
1048500059 8:134967430-134967452 TTTTGTGTGGGCATGGGAAAGGG - Intergenic
1048671927 8:136732332-136732354 TTGTGTGTGAGTAGAGGAGGAGG - Intergenic
1048995469 8:139791310-139791332 GTGTGTCTGTGCAGGGGAGACGG - Intronic
1048995501 8:139791565-139791587 GTGTGTCTGTGCAGGGGAGATGG - Intronic
1049431766 8:142568642-142568664 TTGTGGGTGTGGAAAGGAGGCGG - Intergenic
1050391044 9:5144854-5144876 TTGTGTCTTTGCATGTGAGATGG + Intronic
1050490236 9:6181099-6181121 ATGTGTCTCTGCATATGAGATGG + Intergenic
1050738165 9:8788277-8788299 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1050860129 9:10418436-10418458 GTGTGTGTGTGTAGAGGGGAAGG - Intronic
1051192804 9:14532991-14533013 TTGTGTGTGTGCTTATTGGAAGG - Intergenic
1051369011 9:16342344-16342366 GTGTGTATGTGCACAGGAGCTGG - Intergenic
1051435990 9:17032676-17032698 TTGTGTGTCTGCATAGGCACTGG + Intergenic
1051567945 9:18521934-18521956 TGGAGTCTGTGCATAAGAGATGG - Intronic
1051701469 9:19828821-19828843 TTGTGTGTGGGATTAGCAGAGGG + Intergenic
1052513669 9:29452825-29452847 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1052640289 9:31158831-31158853 GTGTGTCTCTGCATATGAGATGG + Intergenic
1052667777 9:31517281-31517303 GTGTGTCTTTGCATATGAGATGG + Intergenic
1052696615 9:31887047-31887069 GTGTGTCTCTGCATATGAGATGG + Intergenic
1052717173 9:32130749-32130771 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1052992712 9:34530430-34530452 TTGTGTCTCTGCACATGAGATGG + Intergenic
1053010428 9:34629614-34629636 GTGTGTGAGTGCATAGGTGTGGG - Intergenic
1053056640 9:34996885-34996907 GTGTGTGTGTGCTGGGGAGATGG + Intronic
1053298963 9:36935374-36935396 TTGTTTGTTTGCTTCGGAGATGG - Intronic
1053604727 9:39645577-39645599 TAGTGTGTGCACATATGAGAGGG - Intergenic
1053654479 9:40202204-40202226 TTGTGTGTGTGTAAAAGAGAGGG - Intergenic
1053679175 9:40469227-40469249 GTGTGTCTTTGCATATGAGATGG - Intergenic
1053711869 9:40821407-40821429 ATGTGTGTGTTCATATGACAGGG + Intergenic
1053862542 9:42401588-42401610 TAGTGTGTGCACATATGAGAGGG - Intergenic
1053904872 9:42831414-42831436 TTGTGTGTGTGTAAGAGAGAGGG - Intergenic
1054248815 9:62696839-62696861 TAGTGTGTGCACATATGAGAGGG + Intergenic
1054284543 9:63155717-63155739 GTGTGTCTTTGCATATGAGATGG + Intergenic
1054292256 9:63304765-63304787 GTGTGTCTTTGCATATGAGATGG - Intergenic
1054339529 9:63845607-63845629 GTGTGTGTCTGCACATGAGATGG - Intergenic
1054366594 9:64348421-64348443 TTGTGTGTGTGTAAAAGAGAGGG - Intergenic
1054390274 9:64609237-64609259 GTGTGTCTTTGCATATGAGATGG - Intergenic
1054422407 9:64954656-64954678 ATGTGTGTGTTCATATGACAGGG + Intergenic
1054505443 9:65907068-65907090 GTGTGTCTTTGCATATGAGATGG + Intergenic
1054530117 9:66174109-66174131 TTGTGTGTGTGTAAAAGAGAGGG + Intergenic
1054562926 9:66731365-66731387 TAGTGTGTGCACATATGAGAGGG + Intergenic
1054674222 9:67838161-67838183 TTGTGTGTGTGTAAAAGAGAGGG - Intergenic
1054740477 9:68801144-68801166 TTGTGTGTGTGAGGAGGGGATGG + Intronic
1055206187 9:73733291-73733313 TTGTGTGTGTGCATGTGAAGAGG - Intergenic
1055360469 9:75484487-75484509 TTGTGTCTGTCCATAGCAGGAGG - Intergenic
1056037423 9:82621650-82621672 TAGTGTATGTGAATAGGAGGTGG + Intergenic
1056102928 9:83317179-83317201 GTGTGTGTATGCATGAGAGACGG - Intronic
1056348252 9:85721558-85721580 TTGTGTCTTTGCATGTGAGATGG + Intronic
1056567635 9:87788839-87788861 TTGTGTGTGTGTGTGTGAGATGG + Intergenic
1057691123 9:97287191-97287213 TTGTGTGCGTTCATGAGAGAGGG - Intergenic
1058305614 9:103437479-103437501 GTGTGTGTCTGCATGTGAGATGG + Intergenic
1058408697 9:104705711-104705733 TTGTGTCTTTGCATGTGAGATGG - Intergenic
1058943784 9:109837632-109837654 GTGTGTCTCTGCATATGAGATGG - Intronic
1059369304 9:113812831-113812853 TTGTGTGTGTGGTGAGGGGAGGG - Intergenic
1060184338 9:121554767-121554789 ATGTCTGTGTGCATTGGAAAGGG + Intergenic
1060469034 9:123931870-123931892 GTGTGTGTGTGTGTTGGAGAGGG + Intergenic
1060982437 9:127801464-127801486 GTGTGTGTGTGTATGGGGGAAGG + Intronic
1061005182 9:127924863-127924885 GTGTGTGTGTGTAGAGGGGAGGG - Intronic
1061552169 9:131343265-131343287 GTGTGTCTTTGCATATGAGATGG + Intergenic
1061710031 9:132481095-132481117 TTGTGGGTGTGCAAAGCAGGTGG - Intronic
1061810477 9:133159796-133159818 TTGTGTGTGTGCGTGGCGGAGGG - Intronic
1061923001 9:133792528-133792550 TTGTGTGTGTGTATGTGAGCAGG + Intronic
1203377845 Un_KI270442v1:391422-391444 TTGTGTGTGTGCATATGGTGTGG - Intergenic
1203638550 Un_KI270750v1:136582-136604 CTGTGTGTGTGCAGCAGAGAAGG + Intergenic
1185504477 X:621036-621058 GTGTGTGTGTGTGCAGGAGAGGG - Intergenic
1185722397 X:2393365-2393387 TCTTGTGTGTGCACAGGAGATGG - Intronic
1185722409 X:2393437-2393459 TCATGTGTGTGCACAGGAGATGG - Intronic
1185722441 X:2393583-2393605 TGTCGTGTGTGCAGAGGAGATGG - Intronic
1185722514 X:2393929-2393951 TGTTGTGTGTGCGCAGGAGACGG - Intronic
1185764376 X:2713372-2713394 TTGTGTATGTGCATATGTGTAGG - Intronic
1185836879 X:3352831-3352853 GTGTGTGTGTGTGTAGGAAAGGG + Intergenic
1185853939 X:3516035-3516057 GCGTGTGTGTGTATAGGAGATGG - Intergenic
1186048592 X:5564072-5564094 TTGTATGTGTGCATGAGACAGGG + Intergenic
1186716484 X:12257367-12257389 TTGTGTGTGTGTATGCTAGAAGG - Intronic
1187107127 X:16254784-16254806 TTCTGTGTGTGCCTAGGGGATGG - Intergenic
1187788434 X:22920243-22920265 TTGTGTTTGTGTGTAGGAGAGGG - Intergenic
1187806247 X:23124440-23124462 GTGTGTCTGTGCATGGCAGAGGG - Intergenic
1188037053 X:25330288-25330310 GTGTGTCTGTGCACATGAGATGG - Intergenic
1188623542 X:32256400-32256422 GTGTGTGTTTGCATGTGAGATGG + Intronic
1188702100 X:33277682-33277704 TTGTGTGTGTGTCTATGAAAAGG - Intronic
1188732499 X:33668261-33668283 GTGTGTGTGTATATGGGAGATGG + Intergenic
1188981030 X:36727372-36727394 TTGTGTGTCCTCAAAGGAGAAGG - Intergenic
1188985925 X:36768284-36768306 GTGTGTGTGTGTATTGGGGAGGG - Intergenic
1189156742 X:38765424-38765446 GTGTATGTGTGCATAGGGGTGGG - Intergenic
1189400722 X:40666127-40666149 TGTTGTGTGTGTAAAGGAGAGGG + Intronic
1189740915 X:44116432-44116454 TTGTGTGTGTTGACAGGAGAGGG - Intergenic
1189756775 X:44280020-44280042 GTGTGTGTGTGTATGGGGGATGG - Intronic
1189868843 X:45360913-45360935 TTCTGTGTGAGGATAGGAGAGGG - Intergenic
1190050557 X:47145810-47145832 TTGAGTTTGTGCATAGGAGAGGG + Intronic
1190522146 X:51291264-51291286 TTGTTTGTTTTCCTAGGAGACGG + Intergenic
1191003335 X:55685043-55685065 TTGTGTCTCTGCACATGAGATGG + Intergenic
1191012232 X:55772784-55772806 GTGTGTCTCTGCATATGAGATGG + Intergenic
1191017872 X:55829325-55829347 TTGTGTCTCTGCATGTGAGATGG - Intergenic
1191027668 X:55932256-55932278 GTGTGTGTTTGCATGTGAGATGG + Intergenic
1191124622 X:56941786-56941808 GTGTGTCTGTGCATGTGAGATGG + Intergenic
1191196476 X:57729266-57729288 TTGTGTCTCTGCACATGAGATGG + Intergenic
1191209046 X:57865395-57865417 TTGTGTCTCTGCACATGAGATGG - Intergenic
1191768615 X:64731154-64731176 TTGTGTCTTTGCACATGAGATGG + Intergenic
1191782211 X:64880932-64880954 GTGTGTCTGTGCATGTGAGAAGG - Intergenic
1191828068 X:65387528-65387550 GTGTGTCTGTGCATGTGAGATGG + Intronic
1191906835 X:66102433-66102455 TAGGGTGGGTGGATAGGAGAGGG - Intergenic
1192029176 X:67490597-67490619 GTGTGTCTCTGCATATGAGATGG - Intergenic
1192041793 X:67630527-67630549 GTGTGTCTCTGCATATGAGATGG + Intronic
1192079429 X:68032910-68032932 TTGGGGGTGTGCATAGGTGCAGG - Intergenic
1192155031 X:68738490-68738512 GTGTGTCTCTGCATATGAGATGG - Intergenic
1192243412 X:69352996-69353018 GTGTGTCTCTGCATATGAGATGG - Intergenic
1192271556 X:69584909-69584931 GTGTGTGTGTGTATAGTTGATGG - Intergenic
1192500950 X:71651814-71651836 GTGTGTGTGTGTTTTGGAGACGG + Intergenic
1192663015 X:73061910-73061932 GTGTGTCTCTGCATATGAGATGG - Intergenic
1192825424 X:74691223-74691245 TTGTGTCTCTGCACATGAGATGG + Intergenic
1192847546 X:74922041-74922063 TAGTGTATTTGCATAGGAGAAGG - Intronic
1193056380 X:77155885-77155907 GTGTGTCTTTGCATATGAGATGG - Intergenic
1193295024 X:79823688-79823710 TTGTGTTTGAACAAAGGAGAAGG + Intergenic
1193305018 X:79938948-79938970 TTGGATATGTGCCTAGGAGAAGG + Intergenic
1193461929 X:81800781-81800803 TTGTGTGTGTGCATGTGTGTCGG + Intergenic
1193516804 X:82475963-82475985 GTGTGTTTTTGCATATGAGATGG + Intergenic
1193770841 X:85585399-85585421 TTGTGTCTCTGCATGTGAGATGG - Intergenic
1194630021 X:96271617-96271639 GTGTGTGTCTGCACATGAGATGG - Intergenic
1194803766 X:98302455-98302477 TTGTGTCTCTGCACATGAGATGG - Intergenic
1194826012 X:98563982-98564004 TTGTGTCTCTGCATGTGAGATGG + Intergenic
1194986590 X:100496423-100496445 GTGTGTGTGTGTAGAGGACAGGG + Intergenic
1195063139 X:101216043-101216065 TTGTGTGTGTGTACGTGAGATGG + Intergenic
1195150335 X:102061438-102061460 TTGTGTGTGTGTATGGGGCAGGG - Intergenic
1195661275 X:107381070-107381092 TGGTGTGTGTGTATATGAAATGG - Intergenic
1195943920 X:110189182-110189204 CTGTGTATCAGCATAGGAGATGG - Intergenic
1196229984 X:113210413-113210435 GTGTGTCTCTGCATATGAGATGG + Intergenic
1196367582 X:114941099-114941121 TTGTGTCTTTGCATGTGAGATGG + Intergenic
1196476189 X:116089920-116089942 GTGTGTGTTTGCACATGAGATGG + Intergenic
1196514662 X:116555699-116555721 TTGTGTGTTTGCGTTGGAGTGGG - Intergenic
1196669272 X:118348043-118348065 TTGTGTGTGTGTATTGGGGTGGG + Intronic
1196681217 X:118471843-118471865 GTGTGTGTGTGTTTAAGAGATGG - Intergenic
1196925993 X:120633867-120633889 TTGTGTGTGTGTGTGTGAGACGG - Intergenic
1196946355 X:120830946-120830968 ATGTGTGTCTGCATGTGAGATGG + Intergenic
1197049336 X:122040591-122040613 GTGTGTGCTTGCATATGAGATGG + Intergenic
1197151661 X:123226918-123226940 GTGTGTGTGTGTATTGGAGGGGG - Intronic
1197239477 X:124108289-124108311 GTGTGTGTCTGCATGTGAGATGG + Intronic
1197250056 X:124206426-124206448 TTGTTTGTTTGTTTAGGAGACGG + Intronic
1197473879 X:126896137-126896159 TTGTGTGTATACATAGCAGTGGG - Intergenic
1197624304 X:128784765-128784787 TTGTGTCTCTGCACATGAGATGG - Intergenic
1197896938 X:131326378-131326400 GTGTGTGTGTGTTTGGGAGAGGG + Intronic
1198042554 X:132868038-132868060 TTGTGTCTTTGCACATGAGATGG - Intronic
1198166246 X:134060517-134060539 GTGTGTCTCTGCATATGAGATGG + Intergenic
1198327058 X:135584453-135584475 TTGTGTGTTTGCATACCATAGGG + Intergenic
1198515155 X:137399966-137399988 TTCTGTCTGTGGAAAGGAGAGGG - Intergenic
1198687301 X:139240088-139240110 GTGTGTATTTGCATGGGAGATGG - Intergenic
1198743648 X:139867436-139867458 TTCTGTGTGTGAATGGGAGTGGG - Intronic
1198934613 X:141893676-141893698 CTGTGTGCGTGCATAGGGCAGGG + Intronic
1198986399 X:142459092-142459114 GTGTGTGTGTGTATAGAGGATGG - Intergenic
1199535263 X:148895585-148895607 GTGTGTGTGTGTGTAAGAGAGGG + Intronic
1199644977 X:149899615-149899637 TTGTTTCTGTTCTTAGGAGAAGG + Intergenic
1200398436 X:156004732-156004754 TTATGTGTGTGTATGGGAGTAGG + Intronic
1200574283 Y:4868605-4868627 TTGTGTCTCTGCACATGAGATGG - Intergenic
1200741807 Y:6862328-6862350 GTGTGTCTTTGCATAGGAGATGG + Intergenic
1201012857 Y:9565653-9565675 GTGTGTGTGTGTGTATGAGAGGG - Intergenic
1201239695 Y:11946906-11946928 GTGTGTGTGTGTGTAGGAAAGGG - Intergenic
1201297999 Y:12481538-12481560 TTGTGTCTTGGCATATGAGAGGG - Intergenic
1201745911 Y:17373312-17373334 GTGTGTGTGTGCAGAGGTGGGGG - Intergenic
1201775980 Y:17666453-17666475 GTGTGTCTCTGCATATGAGATGG + Intergenic
1201825576 Y:18239539-18239561 GTGTGTCTCTGCATATGAGATGG - Intergenic