ID: 933002286

View in Genome Browser
Species Human (GRCh38)
Location 2:76940475-76940497
Sequence CAGGTCTACCTGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1539
Summary {0: 1, 1: 2, 2: 44, 3: 335, 4: 1157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933002286 Original CRISPR CAGGTCTACCTGAGGGTGGA GGG Intronic
900011208 1:110774-110796 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
900027312 1:287338-287360 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
900041270 1:466782-466804 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
900062701 1:701758-701780 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
900820810 1:4886516-4886538 GGGGTCTATCGGAGGGTGGAGGG - Intergenic
902087063 1:13871423-13871445 GAGGTCTACTTGATGGGGGAGGG - Intergenic
902175067 1:14643323-14643345 GGGGTCTACTTGAAGGTGGAGGG - Intronic
903372175 1:22843498-22843520 GGGGCCTACTTGAGGGTGGAGGG - Intronic
903898977 1:26629069-26629091 GGGGTCTATTTGAGGGTGGAGGG - Intergenic
903927369 1:26840154-26840176 CAGGTCTTCCTCAGGGGAGAGGG - Intronic
904233001 1:29092704-29092726 AGGGCCTACTTGAGGGTGGAGGG - Intronic
904309505 1:29619190-29619212 GTGGCCTACCTGAGGGTGGAAGG + Intergenic
904411680 1:30328648-30328670 CAGTTCTTCATGAGGGTGGAGGG - Intergenic
904443559 1:30549894-30549916 GTGGTCTACTTGAGGGAGGAAGG - Intergenic
904717747 1:32481760-32481782 GGGGTCTACCGGAGGGTGGGAGG - Intronic
905154526 1:35964278-35964300 GGGGTCTACCAGAGGGTAGAGGG - Intronic
906193717 1:43915549-43915571 CAGTTCTGCCTTGGGGTGGAGGG + Intronic
906429316 1:45742206-45742228 CGGGCCTACTTGAGAGTGGAGGG + Intronic
906449650 1:45934072-45934094 AAGGCCTACATCAGGGTGGAGGG - Intronic
906711712 1:47935076-47935098 CTTGTCTACCTGCGGGTGGGAGG - Intronic
906737754 1:48148700-48148722 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
906836786 1:49092019-49092041 GGGGCCTACTTGAGGGTGGAGGG + Intronic
906887917 1:49672329-49672351 GGGGTCTACTTGAGGGGGGAGGG + Intronic
907379717 1:54076253-54076275 GAGGTCTACTTGAGGGTGGAGGG - Intronic
907513613 1:54980074-54980096 CAGTTCTCCTTGAGGGAGGAAGG + Intergenic
907770214 1:57454493-57454515 GGGGTCTACTTGAGGATGGAGGG + Intronic
908080683 1:60574783-60574805 GAGGCCTACCTGAGGATGGAGGG - Intergenic
908083065 1:60601020-60601042 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
908306883 1:62827811-62827833 CGGGTCTACTTGAGGATGGAGGG - Intronic
908314901 1:62922910-62922932 GCAGCCTACCTGAGGGTGGAGGG - Intergenic
908507578 1:64820565-64820587 GCTGTCTACATGAGGGTGGAGGG - Intronic
908887317 1:68804449-68804471 AGGGCCTACATGAGGGTGGAGGG + Intergenic
908905468 1:69003876-69003898 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
908965629 1:69758661-69758683 GGGGCCTACCTGAGGGTGGAGGG - Intronic
908980545 1:69951777-69951799 GGGGTCTACGTGAGGATGGAGGG + Intronic
909102009 1:71359450-71359472 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
909442883 1:75717450-75717472 TGGGGCTACTTGAGGGTGGAGGG + Intergenic
910139751 1:84014060-84014082 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
910166353 1:84331889-84331911 GGGGCCTACTTGAGGGTGGAGGG - Intronic
910370489 1:86510430-86510452 GTGGTCTACTTGAGGATGGAGGG + Intergenic
910645230 1:89507228-89507250 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
910731629 1:90403970-90403992 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
910733370 1:90423255-90423277 GGGGTCTATCAGAGGGTGGATGG + Intergenic
910788415 1:91025240-91025262 AGGGCCCACCTGAGGGTGGATGG - Intergenic
911005101 1:93212494-93212516 GGGGTCTATCAGAGGGTGGAGGG - Intronic
911124880 1:94332183-94332205 TGGGCCTGCCTGAGGGTGGATGG + Intergenic
911314338 1:96338019-96338041 AGGGTCTACTTGAGGATGGAGGG + Intergenic
911543929 1:99192703-99192725 AGGGTCTACTTGAGGGTAGAGGG + Intergenic
911667848 1:100574370-100574392 GGGGTCTACCTGAGAGTGAAGGG + Intergenic
912062904 1:105696363-105696385 GAGGTCTGCTTGAGGGTGGTAGG - Intergenic
912140153 1:106714867-106714889 GGGGCCTACCTGAGGGTGGGAGG - Intergenic
912326083 1:108764038-108764060 TAGGCCTACTTGAGGGTAGAGGG - Intronic
912611218 1:111046680-111046702 GTGGCCTACCTGAGGGTGGAGGG - Intergenic
912647831 1:111411716-111411738 GAGGTTTTCTTGAGGGTGGAGGG + Intergenic
912732622 1:112122608-112122630 GGGGTCTGCTTGAGGGTGGAAGG + Intergenic
913366006 1:118039633-118039655 CAGGGCTACTTGAGGGTGGGAGG + Intronic
914414157 1:147462908-147462930 GGGGTCTACTTGAGGGTGAAGGG - Intergenic
914899186 1:151702968-151702990 TACCTCTAGCTGAGGGTGGAGGG + Exonic
915547512 1:156609748-156609770 CAGGCCTACTTGAGGGAGGAGGG + Intergenic
915696212 1:157745163-157745185 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
915946648 1:160157340-160157362 AAGGCCTACTTGAGGGTGGAGGG - Intronic
916017858 1:160766075-160766097 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
916124172 1:161554525-161554547 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
916173305 1:162018120-162018142 AAGGGCTGCCTGATGGTGGAGGG + Intronic
916373866 1:164130107-164130129 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
916457423 1:164985283-164985305 AGGGCCTACTTGAGGGTGGAAGG - Intergenic
916789614 1:168113814-168113836 AAGGCCTACTTGAGAGTGGAGGG + Intronic
917039446 1:170788137-170788159 CAGGCCTACATGAAGATGGAGGG + Intergenic
917172796 1:172196060-172196082 TGGGTCTACTTGAGGGTGGAGGG - Intronic
917253562 1:173089339-173089361 GGGGTCTACTTGAGGGAGGAGGG - Intergenic
917681356 1:177371400-177371422 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
917820820 1:178762012-178762034 AGGGCCTACTTGAGGGTGGAGGG - Intronic
917990162 1:180367543-180367565 GGGGTCTGCTTGAGGGTGGAGGG - Intronic
918024419 1:180728996-180729018 GGGGCCTACTTGAGGGTGGAGGG - Intronic
918135690 1:181672223-181672245 GGGGTCTACTTGAGTGTGGAGGG + Intronic
918198919 1:182248706-182248728 GGGGTCTACTAGAGGGTGGAGGG - Intergenic
918558623 1:185836784-185836806 CAGGTCTACTTGAAGGTGGAGGG - Intronic
918858708 1:189793728-189793750 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
918948626 1:191105477-191105499 CAGACCTATCTGAGAGTGGAGGG - Intergenic
919190575 1:194212170-194212192 GAGGCCTAACTGAGGGTGGAAGG + Intergenic
919191566 1:194227845-194227867 GGGGCCTACCTTAGGGTGGAGGG + Intergenic
919235239 1:194832357-194832379 GGGGTCTACCAGAGGGTGGAGGG + Intergenic
919559979 1:199105381-199105403 GGGGACTACTTGAGGGTGGAGGG - Intergenic
919947829 1:202334367-202334389 GGGGCCTACCTGAGGGTGGAGGG + Intronic
919965087 1:202515131-202515153 GGGGTCTACTTGAGGGAGGAGGG + Intronic
920596893 1:207280893-207280915 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
920687957 1:208124206-208124228 GGGGCCTACTTGAGGGTGGAGGG + Intronic
921104810 1:211965780-211965802 GGGGCCTACCTGAGGGTGGAAGG + Intronic
921120763 1:212134867-212134889 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
921302449 1:213764169-213764191 CAGGTCTTGCTGAGAGTTGACGG + Intergenic
921366232 1:214377362-214377384 GGGGCCTACCTGAGGGTGGAGGG + Intronic
921517389 1:216112615-216112637 GGGGTCTATCTGAGGGTGAAGGG - Intronic
921961266 1:221036863-221036885 GAGGCCTACCAGAGGGTGGAGGG - Intergenic
922114435 1:222597916-222597938 ACGGGCTACTTGAGGGTGGAGGG - Intergenic
922251039 1:223848595-223848617 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
922259650 1:223926776-223926798 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
923002302 1:230017321-230017343 GGGGCCTACCTGAGGCTGGAGGG - Intergenic
923189550 1:231607246-231607268 GGTGTCTACTTGAGGGTGGAGGG - Intronic
923535393 1:234846506-234846528 GGGGTCTACCTGAAGGTGGAGGG - Intergenic
923675610 1:236078444-236078466 GGGGCCTACCTGAGGGTGGAGGG + Intergenic
923822032 1:237455406-237455428 AGGGCCTACTTGAGGGTGGAGGG + Intronic
923855921 1:237845470-237845492 GGGGTTTACTTGAGGGTGGAAGG + Intergenic
923915542 1:238499679-238499701 GGGATCTACTTGAGGGTGGAGGG + Intergenic
924185106 1:241480480-241480502 AGGGTCTATTTGAGGGTGGAGGG - Intergenic
924212963 1:241789721-241789743 GGGGCCTACTTGAGGGTGGAGGG + Intronic
924340813 1:243029332-243029354 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
924388848 1:243528476-243528498 AAGGCCTACTTGAGGGTGGAGGG - Intronic
924819732 1:247477321-247477343 AGGGCCTACCTGAGGGTGAAGGG + Intergenic
924874796 1:248090441-248090463 GGGGCCTACTTGAGGGTGGAAGG - Intronic
924891081 1:248280757-248280779 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
924919866 1:248617348-248617370 CGGGCCTACTTGAGGGTGTAGGG + Intergenic
1063558565 10:7104386-7104408 GAGGTCTACTTGATGGGGGAAGG - Intergenic
1063561813 10:7135202-7135224 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1063762332 10:9094079-9094101 GGGGTCTACTTGCGGGTGGAGGG + Intergenic
1063872586 10:10434683-10434705 CAGGCCTTATTGAGGGTGGAGGG + Intergenic
1064033160 10:11895624-11895646 GAGGATTACTTGAGGGTGGAGGG - Intergenic
1064121860 10:12625687-12625709 CAGATTTCCCTGAGGGTGGCTGG - Intronic
1064268825 10:13847438-13847460 CAGGTATCCCTGGTGGTGGAGGG - Intronic
1064498919 10:15947309-15947331 GGGGTCTACTTGAGGGTGGAAGG - Intergenic
1064605609 10:17035825-17035847 GGGGCCTACCTGAGGGTGGAGGG + Intronic
1064621314 10:17220398-17220420 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1064843258 10:19620320-19620342 GAGGCCTACTTGAGAGTGGAGGG - Intronic
1064892018 10:20186568-20186590 GAGGCCTACCAGAGGGCGGAGGG - Intronic
1065059825 10:21888764-21888786 GGGGTCTACTTGAGGTTGGAGGG + Intronic
1065096055 10:22281970-22281992 GGGGTCTACTTGAGGATGGACGG + Intergenic
1065201763 10:23319158-23319180 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1065368368 10:24956292-24956314 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1065428323 10:25628660-25628682 CAAGGCTACTTGAGGGTGGAGGG - Intergenic
1065445837 10:25797623-25797645 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1065496950 10:26339278-26339300 GAGGCCTACTTGAGCGTGGAGGG + Intergenic
1065602143 10:27379907-27379929 CTGGACTACTAGAGGGTGGAGGG - Intergenic
1066161351 10:32734427-32734449 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1066174161 10:32886631-32886653 GGGGTCTACTTGAGGGGGGAGGG + Intergenic
1066218092 10:33308199-33308221 AGGGTCTACTTGAGGATGGAGGG + Intronic
1066476699 10:35753849-35753871 GGGGGCTACTTGAGGGTGGAGGG - Intergenic
1066715549 10:38282000-38282022 GGGGTCTACTTGAGAGTGGAGGG + Intergenic
1066735658 10:38476075-38476097 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1067162650 10:43840379-43840401 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1067265836 10:44744379-44744401 GACGCCTACCTGAGGGTGGAGGG - Intergenic
1067319340 10:45202978-45203000 GGGGTCTACTGGAGGGTGGAAGG - Intergenic
1067665760 10:48277131-48277153 GGGGTCTACCTGAGGGTTGGGGG - Intergenic
1067915359 10:50392020-50392042 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1068086581 10:52381097-52381119 AGGGTCTACTTGAGGGTAGAAGG - Intergenic
1068107452 10:52636905-52636927 GAGGTCTAGTTGAAGGTGGAGGG - Intergenic
1068271379 10:54730386-54730408 AGGGCCTACCTGAGGGTAGAGGG + Intronic
1068573677 10:58659547-58659569 GCGGCCTAACTGAGGGTGGAGGG + Intronic
1068712073 10:60146454-60146476 AAGGCCTACTTGGGGGTGGAGGG - Intronic
1068753525 10:60624040-60624062 GAGGCCTACTTGAGGGTAGAGGG + Intronic
1068987816 10:63123248-63123270 TGGGCCTGCCTGAGGGTGGAGGG - Intergenic
1070115984 10:73529285-73529307 CAGGCCTATCGGAGGGTGGAGGG + Intronic
1070442280 10:76458530-76458552 CAGTGGTACCTGAGGGTGAATGG + Intronic
1070455992 10:76616204-76616226 CGGGTCTACTTGAGGGTGGAAGG + Intergenic
1070871125 10:79754446-79754468 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1071022631 10:81076581-81076603 AGGCGCTACCTGAGGGTGGAGGG - Intergenic
1071109032 10:82133413-82133435 GGGGTCTACTTGAGGGTGCAGGG - Intronic
1071343547 10:84669929-84669951 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1071410540 10:85388174-85388196 GGGGTCTACTTGAGGGGGGAGGG + Intergenic
1071638059 10:87276654-87276676 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1071657185 10:87461298-87461320 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1071770164 10:88720357-88720379 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1072044461 10:91640761-91640783 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1072115156 10:92363859-92363881 GGGGCCTACCTGAAGGTGGAGGG + Intergenic
1072766401 10:98098236-98098258 CTGGTCTGCCTGAGGGCGGCTGG - Intergenic
1073485655 10:103817309-103817331 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1073500770 10:103934812-103934834 GGGGTCTACCGAAGGGTGGAGGG - Intergenic
1073644694 10:105288673-105288695 GGGGTCTACCAGAGAGTGGAGGG - Intergenic
1073665425 10:105527125-105527147 GAGGCCTACCAGAGAGTGGAGGG + Intergenic
1073678453 10:105676478-105676500 AGGGCCTACCTGAGGTTGGAGGG - Intergenic
1073832301 10:107399153-107399175 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1073992121 10:109273786-109273808 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1074073035 10:110092556-110092578 CCGGTCTACTTGAGTGGGGAAGG + Intronic
1074110574 10:110419883-110419905 CAGGTGAGCCTGAGGGTGGCAGG + Intergenic
1074239848 10:111627255-111627277 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1075162525 10:120037085-120037107 AAGGCCTACTTGAGGGTGGAAGG + Intergenic
1075333048 10:121588229-121588251 GAGGTCTACTTGAGGGTGGAGGG + Intronic
1075543433 10:123335305-123335327 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1075622062 10:123935257-123935279 CAGCTCTCCCTGAGAGAGGAGGG - Intronic
1075707287 10:124509030-124509052 AGGGCCTACCTGAGGGTGGAGGG - Intronic
1076404838 10:130204874-130204896 CAGGCCTCCCTGAGGGTGATGGG + Intergenic
1076597389 10:131632560-131632582 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1076712481 10:132346048-132346070 CATCTCCATCTGAGGGTGGAGGG + Intronic
1076967541 11:103012-103034 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1077772114 11:5230980-5231002 CAGGCCTACTTGAGGGTTGAGGG - Intergenic
1077951709 11:6966315-6966337 CGGGCCTAGCTGAGGGTGGAGGG + Intronic
1078159018 11:8824353-8824375 AAGGCCTACTTGAGGGTGAAGGG - Intronic
1078816667 11:14829679-14829701 GGGGCCTACCTGATGGTGGAGGG + Intronic
1079254528 11:18816541-18816563 GGGGCCTACGTGAGGGTGGAGGG + Intergenic
1079285422 11:19126279-19126301 GGGGTATACTTGAGGGTGGAGGG - Intronic
1079306262 11:19326130-19326152 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
1079343800 11:19634326-19634348 GGGGTCTACTTGAAGGTGGAGGG + Intronic
1079576895 11:22015482-22015504 GGGGTTTACCTGAGGGTGGAAGG - Intergenic
1079680273 11:23287754-23287776 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1079702924 11:23571727-23571749 GGGGCCTACCTGAGGGTGGAGGG - Intergenic
1079920770 11:26431558-26431580 GCGGTCTATTTGAGGGTGGAGGG - Intronic
1079945606 11:26736998-26737020 TAGGCCTACTTGAGGGTGGAGGG + Intergenic
1079985706 11:27198315-27198337 CTGGTCTCCCTGAGCTTGGAAGG + Intergenic
1080094106 11:28383962-28383984 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1080480488 11:32644322-32644344 CAGGGCCTACTGAGGGTGGAGGG + Intronic
1080500785 11:32869119-32869141 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1080777374 11:35398499-35398521 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1081402600 11:42660524-42660546 GTGGTCTGCTTGAGGGTGGAGGG + Intergenic
1081425512 11:42922047-42922069 GGGGTCTACTTCAGGGTGGAGGG - Intergenic
1081452978 11:43191119-43191141 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1081508948 11:43748449-43748471 GTGGTCTACTAGAGGGTGGAGGG + Intronic
1081537411 11:44005720-44005742 CAGCTTTACCTGGGGGTAGAGGG - Intergenic
1081565899 11:44261144-44261166 CAGGCCTAGCTGGGGGAGGATGG - Exonic
1082179723 11:49102792-49102814 CTGGACTACGTGAGGGTCGAGGG - Intergenic
1082193104 11:49270733-49270755 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1082218002 11:49598038-49598060 GGGGACTACTTGAGGGTGGAGGG - Intergenic
1082641805 11:55670009-55670031 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1082981451 11:59127222-59127244 GGGGCCTACTTGAGGGTGGAGGG + Exonic
1083677770 11:64336556-64336578 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1084390829 11:68875654-68875676 GTGGTCTACTTGAGGGTGGAGGG + Intergenic
1084439311 11:69162642-69162664 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
1084445768 11:69202686-69202708 CAGGTCTGCCTGAGGGTGAGAGG - Intergenic
1084593762 11:70105251-70105273 CGAGGCTTCCTGAGGGTGGAGGG - Intronic
1084599918 11:70138934-70138956 GAGGCCTACTCGAGGGTGGAGGG - Intronic
1084841482 11:71854526-71854548 AAGGCCTACCTGGGGGTGGAGGG + Intergenic
1085439379 11:76544485-76544507 CTGGTCTGCCTGCAGGTGGATGG - Exonic
1085790058 11:79489459-79489481 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1085881141 11:80467250-80467272 GGGGTCTACCTGAGGGTAGTGGG + Intergenic
1085906377 11:80769245-80769267 CAGGCCCACTTGAGGGTAGAAGG + Intergenic
1086526405 11:87732241-87732263 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1086563216 11:88192891-88192913 GAGGCTTACCTGAGGGTGGAGGG - Intergenic
1086631570 11:89026150-89026172 GGGGACTACTTGAGGGTGGAGGG + Intronic
1086664189 11:89459285-89459307 GGGGTCTACTTGAGGGTAGAGGG + Intronic
1086673025 11:89570334-89570356 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1086685559 11:89730120-89730142 CTGGACTACTTGAGGGTGGAGGG + Intergenic
1087167110 11:95016002-95016024 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1087181183 11:95144085-95144107 TAGGTCTTCCTGAGGGAGGGAGG - Intergenic
1087853974 11:103068672-103068694 GGGGTCTACTTGAAGGTGGAGGG + Intronic
1087873116 11:103324326-103324348 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1087978087 11:104575397-104575419 GGGGTCTACTTGAGGGTAGAGGG + Intergenic
1088099414 11:106138634-106138656 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
1088418537 11:109617304-109617326 AAGGCCTACTTGAGGGTGGAGGG + Intergenic
1088570661 11:111220379-111220401 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
1088620389 11:111675906-111675928 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1089763160 11:120743411-120743433 GGGGTCTACTTGAGGGTGGAAGG + Intronic
1090096626 11:123748375-123748397 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1090143857 11:124296519-124296541 GGGGTCTACTTGAGGGTTGAAGG - Intergenic
1090217066 11:124978007-124978029 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1090538027 11:127667391-127667413 GGGGTCTGCTTGAGGGTGGAGGG + Intergenic
1091815870 12:3437521-3437543 GAGGCCTACTTGAGGGTAGAGGG - Intronic
1091884106 12:4003433-4003455 CAGGACTACCTTGGGCTGGAAGG + Intergenic
1091901779 12:4149885-4149907 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1092003165 12:5047679-5047701 CAGGTCTCCCTGTGGGTGAGAGG + Intergenic
1092440804 12:8500488-8500510 AGGGCCTACTTGAGGGTGGAAGG + Intergenic
1092514146 12:9190483-9190505 GGGGCCTATCTGAGGGTGGAGGG + Intronic
1092581003 12:9841300-9841322 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1092632859 12:10402599-10402621 GTGGCCTACCTGAGGGTAGAGGG + Intronic
1092724386 12:11470787-11470809 GGCGTCTACTTGAGGGTGGACGG + Intronic
1093097788 12:14991745-14991767 GGGGTCTACTTGAAGGTGGAGGG + Intergenic
1093218493 12:16390450-16390472 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1093429043 12:19063447-19063469 GAGGTCTACTTGAGGGAGGAGGG - Intergenic
1093586351 12:20841729-20841751 GAGGCCTACTTGAGGGTGGAGGG - Intronic
1093598555 12:20992474-20992496 GAGGCCTACTTAAGGGTGGAAGG - Intergenic
1093611284 12:21161498-21161520 GGGGTCTAGCTGAGGTTGGAGGG + Intronic
1093968598 12:25353306-25353328 CAGGTCTACTCGAGGGTAGAGGG + Intergenic
1094171122 12:27493167-27493189 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1094226008 12:28046963-28046985 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1094255536 12:28421362-28421384 AGGGCCTACCTGAGGGTGGAGGG - Intronic
1094257108 12:28444667-28444689 GGGGTCTACTTGAGAGTGGAGGG + Intronic
1094407463 12:30132727-30132749 AGGGTCTACTCGAGGGTGGAGGG + Intergenic
1094478153 12:30858306-30858328 CGGGCCTACTTGAGGGTGAAGGG - Intergenic
1094722590 12:33079590-33079612 AGGGTCTACTTGAGGGTAGAGGG - Intergenic
1094782193 12:33803557-33803579 GGGGTCTACCAGAAGGTGGAGGG - Intergenic
1095218848 12:39583674-39583696 CAGGTCTACTTGAGGATTGGAGG - Intronic
1095513885 12:42984624-42984646 GGGGCCTACCTGAGTGTGGAAGG + Intergenic
1095555863 12:43503721-43503743 TGGGCCTACTTGAGGGTGGATGG - Intronic
1095575095 12:43727671-43727693 ATGGCCTACTTGAGGGTGGAGGG + Intergenic
1095620067 12:44242293-44242315 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1095842910 12:46714024-46714046 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1095846360 12:46749666-46749688 AAGGTCTCCTTGAGGGTGAAGGG + Intergenic
1096809257 12:54159264-54159286 CAGCTCTACCTGTTGGGGGACGG - Intergenic
1096894256 12:54804464-54804486 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1096945853 12:55409219-55409241 CAGGCCTACTTGAGGGTGGAAGG - Intergenic
1097097458 12:56560917-56560939 GGGGTCTGTCTGAGGGTGGAGGG - Intronic
1097292886 12:57934068-57934090 GGGGTCTGCTTGAGGGTGGAGGG - Intergenic
1097318069 12:58194497-58194519 GGGGTCTATTTGAGGGTGGAGGG - Intergenic
1097431376 12:59512075-59512097 GAGGCCTACTTGAGGGTGGAGGG + Intergenic
1097489011 12:60240890-60240912 GGGGTCTTCCTGAGGGTGCAGGG - Intergenic
1097610698 12:61816177-61816199 GGGGTCTACTTGATGGTGGAGGG - Intronic
1098347326 12:69519559-69519581 GTGGCCTACCAGAGGGTGGAGGG - Intronic
1098399751 12:70061912-70061934 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1098508528 12:71283553-71283575 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1098603056 12:72356371-72356393 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1098872187 12:75828901-75828923 GGGGTCTACTTGAGGGTGGAAGG - Intergenic
1098945719 12:76587431-76587453 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1098999836 12:77166521-77166543 AAGGCCTACTTGAGGGTGAAGGG + Intergenic
1099220780 12:79911433-79911455 GGGGCCTACCTGAGGGTGGAGGG + Intronic
1099404176 12:82239674-82239696 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1099580885 12:84445747-84445769 CGAGTCTATCAGAGGGTGGAAGG - Intergenic
1099648673 12:85395531-85395553 AAGGTCTACTTGAGGGAGGATGG - Intergenic
1099651799 12:85438072-85438094 AAGGCCTACTTGAGGGTGAAGGG - Intergenic
1099663196 12:85593161-85593183 TGGGGCTACTTGAGGGTGGAGGG - Intergenic
1099844210 12:88008218-88008240 GGGGTCTACCAGAGGGTAGAGGG - Intronic
1099866076 12:88282792-88282814 GGGGCCTACCTGAGGATGGAGGG + Intergenic
1100001770 12:89845185-89845207 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1100226815 12:92565860-92565882 TGGGGCTACTTGAGGGTGGAAGG + Intergenic
1100251587 12:92830325-92830347 CAGACCTGCTTGAGGGTGGAAGG - Intronic
1100344006 12:93709414-93709436 CGGGTCTACTTGAGGGGAGAGGG - Intronic
1100454506 12:94739383-94739405 CGGGTCTACTTGAGGGTGGCGGG - Intergenic
1100637993 12:96454165-96454187 GGGGTCTCCTTGAGGGTGGAAGG + Intergenic
1100675068 12:96857293-96857315 AGGGTCTACTTGAGGGTAGAAGG - Intronic
1100696202 12:97096792-97096814 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1101067320 12:101035840-101035862 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1101806749 12:108070674-108070696 GGGATCTACTTGAGGGTGGATGG - Intergenic
1102057344 12:109906558-109906580 CAGCTCCATCTGAGGATGGAAGG - Exonic
1102814544 12:115853831-115853853 GAGGCCTACTTGAGGGTGGAGGG - Intergenic
1103032969 12:117632691-117632713 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1104155786 12:126130400-126130422 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1104298032 12:127536381-127536403 AGGACCTACCTGAGGGTGGAGGG + Intergenic
1104491126 12:129194446-129194468 GGGGTCTACGTGAGGGTGGAGGG + Intronic
1104496819 12:129248712-129248734 AGGGTCTAACAGAGGGTGGAGGG - Intronic
1104616898 12:130278170-130278192 AGGGCCTACCTGAGGGTGAAGGG + Intergenic
1104677814 12:130726562-130726584 ACTGTCTACCTGAGGGTGGAGGG + Intergenic
1105976200 13:25475173-25475195 GAGGCCTGCTTGAGGGTGGAGGG - Intronic
1106048489 13:26168034-26168056 GGGGCCTACCTTAGGGTGGAGGG + Intronic
1106426902 13:29639932-29639954 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1107116105 13:36747386-36747408 GGGGCCTACCTGAGGGTGGAGGG - Intergenic
1107162034 13:37241481-37241503 GGGGTCTGCCTGTGGGTGGAAGG + Intergenic
1107345938 13:39460989-39461011 TAGGCCTACTTGAGGGTGGAGGG - Intronic
1107703938 13:43080229-43080251 GAGGCCTACCTGAGGGTGGAGGG - Intronic
1108141777 13:47431034-47431056 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1108162332 13:47653999-47654021 AAGGGTTACTTGAGGGTGGAAGG - Intergenic
1108467878 13:50736340-50736362 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1108787794 13:53926957-53926979 GGGGTCTACTTGAGGCTGGAGGG - Intergenic
1108982573 13:56537338-56537360 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1109158289 13:58939342-58939364 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1109400391 13:61820104-61820126 CAGAGCTACTTGAGGGTGGAGGG + Intergenic
1109771766 13:66983866-66983888 GGGGCCTGCCTGAGGGTGGAGGG - Intronic
1110020703 13:70466744-70466766 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1110313393 13:74076798-74076820 GGGGTCGACTTGAGGGTGGAGGG - Intronic
1110334633 13:74313255-74313277 TGGGCCTACCTGAGTGTGGAGGG - Intergenic
1110387270 13:74928030-74928052 AAGGCCTACTTGAGGGTGGAAGG - Intergenic
1110743162 13:79020983-79021005 GAGGCCTACCTGAGAGTGGAGGG + Intergenic
1110829990 13:80019604-80019626 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1110866468 13:80401646-80401668 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1111000654 13:82175480-82175502 GAGGCCTACTTGAGGGTGGAGGG + Intergenic
1111350153 13:87017828-87017850 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1111363001 13:87200959-87200981 GAGGTCTACCTGAGTGTAGAGGG + Intergenic
1111449912 13:88401517-88401539 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1111646219 13:91035001-91035023 GTGGCCTACTTGAGGGTGGAAGG + Intergenic
1112446201 13:99466438-99466460 CGGGCCTACTTGAGGGTGGAGGG - Intergenic
1112460260 13:99597822-99597844 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1112866396 13:103906269-103906291 TAGGCCTACTTGAGGGTGGAGGG - Intergenic
1112912573 13:104506287-104506309 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1112916603 13:104558749-104558771 GGGGTCTACTTGATGGTGGAGGG - Intergenic
1113013360 13:105796460-105796482 CAGGTCTAACTGAGGGAGAAAGG + Intergenic
1113358588 13:109607186-109607208 GGGGCCTACCTGAGGGTAGAGGG - Intergenic
1113363256 13:109651539-109651561 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1113988251 13:114336819-114336841 GGGGTCTACTTGAGGGGGGAGGG + Intergenic
1114159669 14:20150394-20150416 GGGGTCTACTTGAGGATGGAGGG + Intergenic
1114202747 14:20538301-20538323 GAAGCCTACTTGAGGGTGGAGGG - Intergenic
1114279339 14:21176806-21176828 GTGGCCTACCTGAGGGTGGAGGG + Intergenic
1114374352 14:22127873-22127895 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1114760269 14:25306545-25306567 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1114763687 14:25346502-25346524 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
1114902537 14:27082431-27082453 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1115283262 14:31688817-31688839 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1115341896 14:32301421-32301443 AGGACCTACCTGAGGGTGGAGGG - Intergenic
1115391756 14:32861977-32861999 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1115886862 14:37981771-37981793 TAGGTCTACTCGAGGGTGTAGGG + Intronic
1116252932 14:42509976-42509998 GGGGTCTACTTGAGGGTGGAAGG + Intergenic
1116280002 14:42894505-42894527 GTGGACTACCAGAGGGTGGAGGG - Intergenic
1116319734 14:43446366-43446388 CAGGCCTACTAGAGGGTGGTGGG - Intergenic
1116504257 14:45659438-45659460 GGGGTCTACTTGAGGATGGAAGG - Intergenic
1116535676 14:46026334-46026356 GCGGTCTACTTGAGGGTGGATGG - Intergenic
1116553711 14:46275672-46275694 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1116736215 14:48695510-48695532 GAGGCCTATTTGAGGGTGGAGGG + Intergenic
1116737873 14:48717178-48717200 AGGGCCTACCTGAGGGTGGAGGG - Intergenic
1117165646 14:53029937-53029959 GAGGCCTAGCAGAGGGTGGAGGG - Intergenic
1117244380 14:53869597-53869619 GGGGTCTACTTGAGGGGGGAAGG + Intergenic
1117640684 14:57795953-57795975 GAGGCCTACTTGAGGGTGGAGGG - Intronic
1117671837 14:58115896-58115918 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1117686021 14:58254057-58254079 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1117738442 14:58791079-58791101 GGGGCCTAACTGAGGGTGGAGGG - Intergenic
1117838637 14:59833687-59833709 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1118283490 14:64450143-64450165 CAGGAATACCCCAGGGTGGAGGG + Intronic
1118598820 14:67457116-67457138 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1118680429 14:68236046-68236068 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1118866523 14:69708702-69708724 CAGGTCTCCATCATGGTGGATGG + Exonic
1119489863 14:75022152-75022174 TGGGCCTACTTGAGGGTGGAGGG + Intronic
1119543928 14:75458323-75458345 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1119714256 14:76847526-76847548 GGGGACTAACTGAGGGTGGAGGG + Intronic
1119887458 14:78154840-78154862 CAGGTCTACCTGAGGTCAGTGGG - Intergenic
1120030880 14:79639369-79639391 GAGGTCTACTTGAGGGTAGAGGG - Intronic
1120277946 14:82401168-82401190 GAGGTCTATCGGAGGGTGGAGGG + Intergenic
1120415354 14:84212672-84212694 CGGGCCTACTTGAAGGTGGAGGG - Intergenic
1120458807 14:84767088-84767110 GGGGCCTATCTGAGGGTGGAGGG - Intergenic
1122232024 14:100311097-100311119 GGGGCCTACCTAAGGGTGGAGGG - Intergenic
1122313020 14:100809192-100809214 CAAGTCTCCCTCAGGGCGGAGGG - Intergenic
1122394921 14:101418420-101418442 AAGGTATACATGGGGGTGGAGGG + Intergenic
1122589382 14:102835742-102835764 AGGGCCTACTTGAGGGTGGAAGG + Intronic
1123020160 14:105394280-105394302 CAGGGCTGCCTGCAGGTGGAAGG - Intronic
1123699430 15:22903511-22903533 CGGGTCTACCCTCGGGTGGATGG - Intronic
1123769663 15:23516096-23516118 AGGATCTACTTGAGGGTGGAGGG - Intergenic
1123814014 15:23958104-23958126 GGGGCCTACCTCAGGGTGGAAGG - Intergenic
1123889431 15:24761436-24761458 GGAGTCTACCTGAGGGTAGAGGG + Intergenic
1124011234 15:25840348-25840370 GGAGTCTACCTGAGGGTGGAGGG - Intronic
1124130499 15:26980911-26980933 GGGGTCTATCTGAGGGTGGAGGG + Intronic
1124228253 15:27916182-27916204 GGAGTCTACTTGAGGGTGGAAGG + Intronic
1124447851 15:29754357-29754379 GGGGTCTACTTGAGGGGGGAGGG + Intronic
1124450422 15:29783789-29783811 GGGGACTACCGGAGGGTGGAGGG + Intronic
1124933824 15:34150761-34150783 GAGGCCTACCTTAGGGTAGAGGG - Intronic
1125090097 15:35780589-35780611 GGGGCCTTCCTGAGGGTGGAGGG + Intergenic
1125247756 15:37660942-37660964 CGGGCCTACTAGAGGGTGGAAGG - Intergenic
1125273788 15:37969708-37969730 CAAGTGTACTTGAGGGTGGAAGG - Intergenic
1125382830 15:39105234-39105256 GGGGTCTACTTGAGGGTGGAAGG - Intergenic
1125529176 15:40400579-40400601 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1125780754 15:42264857-42264879 TGGGCCTACTTGAGGGTGGAGGG - Intronic
1125873783 15:43126142-43126164 CGGACCTACTTGAGGGTGGAGGG + Intronic
1126467915 15:48977253-48977275 AGGGCCTGCCTGAGGGTGGAGGG - Intergenic
1126507166 15:49418632-49418654 GGGGTCCACTTGAGGGTGGAGGG + Intronic
1127055140 15:55123667-55123689 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1127902980 15:63354836-63354858 AAGGACTTCCTGAGGGTGGGTGG - Intronic
1128408035 15:67363712-67363734 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1128699061 15:69790722-69790744 CTGGTCTATCTGAGGGTGGCTGG + Intergenic
1129081806 15:73047902-73047924 CGGGTCTACTTTAGGGTAGAGGG - Intergenic
1129491321 15:75928571-75928593 GGGGCCTACCAGAGGGTGGAGGG + Intronic
1129965685 15:79733420-79733442 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1130179489 15:81610638-81610660 GGGGACTACCAGAGGGTGGAGGG + Intergenic
1130439449 15:83937497-83937519 AGGGTCTACTTGAGGGTGGAAGG + Intronic
1130909164 15:88259130-88259152 AGGGTCTACCAGAGGGTAGAAGG + Intergenic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131308011 15:91262614-91262636 GAGGTCTACTTGGGGGTGGAGGG - Intronic
1131314813 15:91326014-91326036 AAGGCCTACCTGAGGGTGGAGGG - Intergenic
1131618419 15:94041199-94041221 GGGGTCTACTTGAGGGTGCAGGG + Intergenic
1131956176 15:97738677-97738699 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1132107952 15:99077844-99077866 GAGGACCACCTAAGGGTGGAGGG - Intergenic
1132110159 15:99096966-99096988 CAGGCCTAGCAGAGGGCGGATGG + Intergenic
1133614160 16:7460554-7460576 GGGGTCTACCAGAGGGTGGAAGG + Intronic
1133839797 16:9397393-9397415 CAGAGCTGCGTGAGGGTGGAAGG + Intergenic
1133917892 16:10125691-10125713 CAGGCCTACAGGAGGCTGGATGG + Intronic
1134284809 16:12851545-12851567 GGGCTCTACTTGAGGGTGGAGGG + Intergenic
1134285816 16:12861329-12861351 GAGGCCTACCAGAGGGTAGAGGG + Intergenic
1134350464 16:13432903-13432925 GGGGTCTATCGGAGGGTGGAGGG + Intergenic
1134789692 16:16978380-16978402 TAGGCCTACTTGAGGGTGAAGGG + Intergenic
1135246932 16:20864971-20864993 GGGGTCTACTTGAGGGTAGAGGG + Intronic
1135782542 16:25317182-25317204 TGGGCCTACCAGAGGGTGGAAGG + Intergenic
1137544014 16:49386600-49386622 GGGGCCTACCTGAGGGTGGAGGG - Intronic
1137628249 16:49923017-49923039 CTGGTCTCTCTGAGGCTGGAAGG - Intergenic
1137837142 16:51603463-51603485 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1138826112 16:60322235-60322257 GGGGTCTACCTGAGACTGGAGGG - Intergenic
1139107194 16:63841041-63841063 GTGGCCTACTTGAGGGTGGAGGG + Intergenic
1139154188 16:64421302-64421324 AGGGTCTACTTGAGGGTGTAGGG - Intergenic
1139924161 16:70476612-70476634 CAGGTCCACCTCAGGGTGTCAGG + Intronic
1139938642 16:70589393-70589415 GGGGTCTATCTGAAGGTGGAGGG - Intronic
1140252799 16:73309232-73309254 TGGGGCTACCTGAGAGTGGAGGG - Intergenic
1140460202 16:75133424-75133446 GGGGTCTATCTGACGGTGGAGGG - Intergenic
1140542008 16:75764823-75764845 TGGGCCTACTTGAGGGTGGAGGG - Intergenic
1140545351 16:75802664-75802686 GGGGCCTACCTGAGGGTGGAGGG - Intergenic
1140552329 16:75880147-75880169 TGGTTCTACTTGAGGGTGGAGGG - Intergenic
1140572224 16:76120927-76120949 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1140685425 16:77429422-77429444 GAGGTCTACTTGGGGGTGGAGGG + Intronic
1142233454 16:88910576-88910598 CAGCTCTTCCTGAGGTGGGAGGG - Intronic
1142453141 16:90196131-90196153 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1143428170 17:6857025-6857047 GAGGCGTACTTGAGGGTGGAGGG - Intergenic
1144393356 17:14817827-14817849 CAGGCCTACTTGAGAGTGGAAGG - Intergenic
1145202658 17:20960747-20960769 GGGGCCTACCTGAGGGTGGAGGG - Intergenic
1145275085 17:21424359-21424381 CTGCTCGACCTGAGGGAGGATGG + Intergenic
1145312939 17:21710259-21710281 CTGCTCGACCTGAGGGAGGATGG + Intergenic
1145728583 17:27155748-27155770 CAGGCCTACCTTACGGTGTAGGG - Intergenic
1147695862 17:42352363-42352385 CAGGTGAATCTTAGGGTGGAAGG - Intronic
1148279795 17:46339035-46339057 GGGCCCTACCTGAGGGTGGAGGG + Intronic
1148302013 17:46556891-46556913 GGGCCCTACCTGAGGGTGGAGGG + Exonic
1148567623 17:48642874-48642896 CAGGTCTCTCAGGGGGTGGAGGG - Intergenic
1148663863 17:49360887-49360909 CAGGTGTTCCTGAGGGTCCACGG + Intronic
1149247979 17:54733976-54733998 GAGGTCTACTTGAGGGTGGAAGG + Intergenic
1149381335 17:56097078-56097100 CATGTGTACTTGAGGGTGGAGGG + Intergenic
1149742040 17:59055762-59055784 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1150048470 17:61936153-61936175 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1150400217 17:64850439-64850461 GGGCCCTACCTGAGGGTGGAGGG - Intergenic
1150439650 17:65180802-65180824 CAGGCCTACTTGAGGGTGGAGGG - Intronic
1150831667 17:68526755-68526777 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1150846776 17:68666470-68666492 GGGGTCTACTTGAGGGGGGAGGG - Intergenic
1150996456 17:70323302-70323324 CATTTCAACCTGAGGGTGAAAGG + Intergenic
1150998856 17:70350950-70350972 GGGGTCTACCTGAAGGTGGAGGG + Intergenic
1151021240 17:70619757-70619779 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1151060713 17:71090575-71090597 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1151069810 17:71196039-71196061 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1151571215 17:74926517-74926539 TAGGTCTTGCTCAGGGTGGAAGG - Intronic
1152658018 17:81528938-81528960 CAGGTGGGCCTGCGGGTGGATGG - Exonic
1152734253 17:81989381-81989403 CAGGTCTGCATGAGGGAGGGAGG + Intronic
1153061324 18:997965-997987 GAGGCCTACTTGAGGATGGAGGG + Intergenic
1153168303 18:2286715-2286737 GAGGCCTACTTGAGGGTGAAGGG - Intergenic
1153242721 18:3045214-3045236 CAAGGCCAGCTGAGGGTGGAAGG + Intergenic
1153329147 18:3855269-3855291 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1153359516 18:4177619-4177641 AGGGCCTACATGAGGGTGGATGG - Intronic
1153411226 18:4795587-4795609 GGGACCTACCTGAGGGTGGAGGG + Intergenic
1153723793 18:7935822-7935844 AGGGTCTACTTTAGGGTGGAGGG - Intronic
1154183113 18:12154957-12154979 AAGGTCTGCTTGAGAGTGGAAGG + Intergenic
1154295981 18:13148737-13148759 GGGGTCTACCTGAAGGTGGATGG - Intergenic
1155110109 18:22706408-22706430 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1155262510 18:24058149-24058171 AGGGTCTACTTGAGGGTGGAGGG + Intronic
1155304962 18:24469916-24469938 GGGGCCTACCTGAGGGTGGTGGG - Intronic
1155328232 18:24687709-24687731 GAGGCCTACTTGAGGATGGAGGG - Intergenic
1155561778 18:27086104-27086126 CAGGCCTACTTGAGGGTGGAGGG + Intronic
1155576916 18:27258617-27258639 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1155770805 18:29695780-29695802 GGGGTCTACTTGAGGGTGGAAGG - Intergenic
1155844730 18:30691648-30691670 GGGGTGTACTTGAGGGTGGAAGG - Intergenic
1155844814 18:30692952-30692974 GGGGCCTACCTGAGGGTGTAGGG - Intergenic
1155926108 18:31657138-31657160 CATGTGTACTTGAGGGTTGATGG - Intronic
1155931281 18:31711410-31711432 TGGGTCTACTTGAGGATGGAGGG - Intergenic
1156051470 18:32940677-32940699 GGGGTCTACTTGAGGGTGAAGGG - Intronic
1156067871 18:33166932-33166954 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1156258856 18:35425969-35425991 GAGGCCTACTTGAGGGTGGAGGG + Intergenic
1156826681 18:41438284-41438306 AGGGCCTACTTGAGGGTGGAAGG - Intergenic
1156928490 18:42612257-42612279 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1157170192 18:45396823-45396845 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1157368383 18:47087534-47087556 GAGGCCTGCTTGAGGGTGGAGGG + Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158055912 18:53279925-53279947 GGGGTCTACTTAAGGGTGGAAGG + Intronic
1158294877 18:55984785-55984807 GGGGCCTACCAGAGGGTGGATGG + Intergenic
1158738086 18:60106930-60106952 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
1158839582 18:61369901-61369923 GGGGTCTAACGGAGGGTGGAAGG + Intronic
1159606023 18:70476191-70476213 GGGGCCTACCTGAGGGTGAAGGG - Intergenic
1159732338 18:72044479-72044501 AAGACCTACTTGAGGGTGGAGGG + Intergenic
1159972532 18:74671512-74671534 GGGGCCTACCTGAGGGTGGAGGG - Intronic
1160227299 18:77020844-77020866 CAGGCCTGCCTAAGAGTGGACGG + Intronic
1160533513 18:79578779-79578801 CAGGACTGCCCGAGTGTGGAAGG + Intergenic
1160644345 19:172635-172657 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1160874675 19:1291481-1291503 CAGGTCTTGCTGGGGGTGGCAGG + Intronic
1160958402 19:1705934-1705956 CAGGTATATGTGTGGGTGGATGG + Intergenic
1161496762 19:4590834-4590856 CAGGTCAACCTGGGGGGAGAGGG - Intergenic
1161998601 19:7729839-7729861 CAGGGCTACCAGTGGGTGGACGG - Exonic
1162101638 19:8342734-8342756 TAGGACGACCTGGGGGTGGACGG - Intronic
1162111188 19:8400547-8400569 CAGATGTACCTGAGGGATGAAGG - Intronic
1162936062 19:13982149-13982171 CAGGTCTCCCTGACGGTCCATGG - Exonic
1163181039 19:15602175-15602197 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1163629159 19:18408278-18408300 TTGTCCTACCTGAGGGTGGAGGG - Intergenic
1163879551 19:19905368-19905390 GAGGCCTAGTTGAGGGTGGAGGG - Intronic
1163884274 19:19952065-19952087 GAGGCCTAGATGAGGGTGGAGGG + Intergenic
1163908968 19:20171872-20171894 GAGGCCTAGTTGAGGGTGGAGGG - Intronic
1163912911 19:20213652-20213674 CAGGCCTAGTTGAGGCTGGAGGG + Intergenic
1163927114 19:20356402-20356424 GAGGCCTAGTTGAGGGTGGAGGG + Intergenic
1163933368 19:20420390-20420412 GAGGCCTAGTTGAGGGTGGAGGG + Intergenic
1163969827 19:20781386-20781408 GAGGCCTAGTTGAGGGTGGAGGG - Intronic
1164022514 19:21321268-21321290 GAGGCCTACTTGAGGGTGGAAGG + Intronic
1164043637 19:21514339-21514361 GAGGCCTAGTTGAGGGTGGAGGG - Intronic
1164509291 19:28884418-28884440 GAGGCCTGCTTGAGGGTGGAAGG - Intergenic
1165079793 19:33300761-33300783 TAGTTCTACATGAAGGTGGAGGG - Exonic
1165890373 19:39108508-39108530 CAGGACTACATGGGGGTTGAAGG + Intronic
1165969132 19:39610754-39610776 GGGGCCTACCTGAGAGTGGAGGG - Intergenic
1166176240 19:41073327-41073349 GGGGCCTCCCTGAGGGTGGAGGG + Intergenic
1166398643 19:42461548-42461570 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1166409130 19:42544721-42544743 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1167747868 19:51363381-51363403 CAAGGCAACCTGAGGGTGTAGGG + Intronic
1167837641 19:52087368-52087390 GGGATCTACCTGAGAGTGGAAGG - Intronic
1167842559 19:52133877-52133899 GGGGCCTACCTCAGGGTGGAGGG - Intronic
1167924059 19:52809465-52809487 GGCGTCTACTTGAGGGTGGAGGG + Intronic
1167995686 19:53400150-53400172 GGCGTCTACTTGAGGGTGGAGGG - Intronic
1168217909 19:54939851-54939873 CCGATCTACGTAAGGGTGGAGGG - Exonic
1168224209 19:54982749-54982771 CCGATCTACATAAGGGTGGAGGG + Exonic
1168311976 19:55465043-55465065 CAGGTGTGTCTGAGGGTGGGTGG - Intergenic
1168389141 19:55992024-55992046 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
1168695297 19:58400812-58400834 CAGGGCCCCCTGAGGGTGGCGGG - Intergenic
925093664 2:1176288-1176310 GAGACCTACCTGAGGGTGAAGGG + Intronic
925154071 2:1637026-1637048 CCGTTCATCCTGAGGGTGGAAGG + Intronic
925302031 2:2823856-2823878 GGGGTCTACTTGACGGTGGAGGG - Intergenic
925565727 2:5252190-5252212 GGGGTCTACTTGAGGGCGGAGGG - Intergenic
925647449 2:6051143-6051165 GAGGCCTACTTGAAGGTGGAGGG + Intergenic
926072055 2:9904260-9904282 AGGGCCTACTTGAGGGTGGAGGG - Intronic
926514586 2:13825915-13825937 GAGGCCTACTGGAGGGTGGAAGG + Intergenic
926545019 2:14229039-14229061 CGGGCCTACTGGAGGGTGGAGGG - Intergenic
926595239 2:14782945-14782967 GAGGCCTCCTTGAGGGTGGAAGG + Intergenic
926835463 2:17014363-17014385 GGGGTCTACTTGAAGGTGGAGGG - Intergenic
926981865 2:18580926-18580948 AGGGCCTACTTGAGGGTGGAGGG + Intronic
927008478 2:18877431-18877453 GGGGTCTATCAGAGGGTGGAGGG - Intergenic
927078502 2:19603668-19603690 AGGGCCTACTTGAGGGTGGAAGG + Intergenic
927329715 2:21848075-21848097 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
927405151 2:22758097-22758119 GAGGTCTGGCTGAGAGTGGAGGG - Intergenic
927828363 2:26326195-26326217 CAGGTCTACCTGTCTGGGGACGG + Intronic
928041535 2:27882915-27882937 GGGGTCTACCTGAGGGTGGAGGG + Intronic
928049759 2:27978794-27978816 GGGGCCTACTTGAGGGTGGAGGG - Intronic
928055996 2:28055251-28055273 AAGGCCTACCCTAGGGTGGAGGG + Intronic
928142723 2:28744608-28744630 AAGGTCTACTTGAGGCGGGAGGG + Intergenic
928432266 2:31230185-31230207 GGGGTCTAGTTGAGGGTGGAGGG - Intronic
928669141 2:33582528-33582550 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
928774831 2:34748347-34748369 AAGGCCTACTTGAGGGTGAAGGG + Intergenic
928876866 2:36050063-36050085 GAGGCCTAGTTGAGGGTGGAAGG - Intergenic
929109540 2:38395217-38395239 CAGGCCGACTTGAGGATGGATGG + Intergenic
929238636 2:39630735-39630757 GGGGTCTACTTGAGGGTGAAGGG - Intergenic
929557621 2:42935409-42935431 GGGGGCTACTTGAGGGTGGAGGG - Intergenic
929718281 2:44336524-44336546 GGGGCCTACCTGAGGGTTGAAGG + Intronic
930141700 2:47957169-47957191 GGGGTCTACTTGAGAGTGGAGGG + Intergenic
930147241 2:48019786-48019808 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
930211300 2:48640516-48640538 TGGGTCTACTTAAGGGTGGAGGG + Intronic
930233636 2:48868045-48868067 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
930302530 2:49634977-49634999 AAGTTCTACTTGAAGGTGGAGGG - Intergenic
930347065 2:50196896-50196918 GAGATCTATTTGAGGGTGGAGGG + Intronic
930450495 2:51530622-51530644 GGGGTCTTCTTGAGGGTGGAGGG - Intergenic
930461999 2:51693160-51693182 CAGAGCTTCTTGAGGGTGGAGGG + Intergenic
930632866 2:53772868-53772890 GGGGTCTACGGGAGGGTGGAGGG - Intronic
931015565 2:57975920-57975942 GGAGTCTACCTGAAGGTGGAGGG - Intronic
931425748 2:62169475-62169497 TGGGTCTACTTGAGGGTGGAGGG - Intergenic
931454404 2:62396752-62396774 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
931557904 2:63525233-63525255 AAGGCCTACCTGAGGGTGGAGGG + Intronic
931921673 2:67023786-67023808 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
932003840 2:67908403-67908425 AGGGCCTACTTGAGGGTGGAAGG + Intergenic
932173243 2:69576497-69576519 GGGGTATACTTGAGGGTGGAGGG - Intronic
932532988 2:72557636-72557658 AAGGTCTACTTGAGGGTGGAGGG + Intronic
932647443 2:73518119-73518141 GGGGCCTACTTGAGGGTGGAGGG - Intronic
932668830 2:73719346-73719368 CAGGTGGACCTGATGGTGGATGG + Intergenic
932679961 2:73816440-73816462 CAGGCCTACGTGAGGCTAGAGGG - Exonic
932913305 2:75828319-75828341 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
933002286 2:76940475-76940497 CAGGTCTACCTGAGGGTGGAGGG + Intronic
933162614 2:79042783-79042805 GGGATCTACCTGAGGGTGAAGGG + Intergenic
933271310 2:80235963-80235985 GGGGTCTACTGGAGGGTGGAGGG - Intronic
933285881 2:80384154-80384176 GAGGTCTACTTGAGGGTGGAGGG + Intronic
933447483 2:82400818-82400840 GTGGTCTACATGAGAGTGGAAGG - Intergenic
933545484 2:83706070-83706092 AAGGCCTACCAGAGGGTGGAGGG - Intergenic
933554185 2:83811178-83811200 GGGGTCTACTTGAGGGTGGCAGG + Intergenic
933587812 2:84199156-84199178 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
933864514 2:86503919-86503941 GGGGCCTACCTGAGGGTGGAGGG + Exonic
934019261 2:87928200-87928222 CGGGCCTATCGGAGGGTGGAAGG - Intergenic
934154329 2:89181695-89181717 GGGGTCTACCTGAGGGTGGAGGG + Intergenic
934212902 2:90000245-90000267 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
935151847 2:100444250-100444272 GGGGCCTACCTGAGGGTGGAGGG + Intergenic
935360566 2:102243300-102243322 CAGGCCTCCCTAGGGGTGGATGG + Intergenic
935491259 2:103723116-103723138 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
935765830 2:106366896-106366918 TGGGTTGACCTGAGGGTGGATGG + Intergenic
936857123 2:116972053-116972075 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
937027132 2:118708565-118708587 GAGGCCTACTTGAGGGTGGAGGG + Intergenic
937397728 2:121553179-121553201 GAGGCCTACTTGAGGGTGGAGGG + Intronic
937503224 2:122506401-122506423 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
937554425 2:123135429-123135451 CAGGATTACTTGAGGGTGTAGGG - Intergenic
937674283 2:124572298-124572320 GGGGTCTACCTGAGGGTGGTGGG + Intronic
937728314 2:125194143-125194165 GAGATCTACTTGAGAGTGGAGGG + Intergenic
937807124 2:126159604-126159626 TATGTGTACTTGAGGGTGGAGGG + Intergenic
938095840 2:128462712-128462734 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
938215974 2:129515633-129515655 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
938395023 2:130939057-130939079 GAGGCCTACTTGAGGGTGGAGGG - Intronic
938623411 2:133082038-133082060 AGGGCCTACTTGAGGGTGGAGGG - Intronic
939111084 2:138008142-138008164 GAGGTCTACTTGAGGATGGAGGG - Intronic
939197710 2:138992609-138992631 GGGGTCTACTTGAGGGTGGATGG + Intergenic
939292026 2:140208151-140208173 GAGGTCTACTTGAAGGTGGAAGG + Intergenic
939713701 2:145556657-145556679 GGGGCCTACCTGAGGGGGGAGGG - Intergenic
940078657 2:149774010-149774032 CGGGTCTACTTGACGGTGGAGGG - Intergenic
940149460 2:150583563-150583585 CAGATCTACTTGAGAGGGGAGGG + Intergenic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940615683 2:156046362-156046384 GAGGGTTACGTGAGGGTGGAGGG + Intergenic
940628664 2:156209593-156209615 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
940831682 2:158473641-158473663 TGGGTCTACTTGAGGGTAGAGGG + Intronic
941055405 2:160782393-160782415 AAGGGCTACTTGAGGATGGAGGG + Intergenic
941353862 2:164465365-164465387 GAGGCCTACTGGAGGGTGGAAGG - Intergenic
941667814 2:168259765-168259787 AAAGTCTACCTGGGGGAGGATGG - Intergenic
941860938 2:170279618-170279640 GAGGCCTACTTGAGGGTGGAGGG - Intronic
941980865 2:171455141-171455163 CGGGCCTATCGGAGGGTGGAGGG - Intronic
942002161 2:171658857-171658879 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
943124460 2:183779420-183779442 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
943312020 2:186337551-186337573 GAGGCCTACTTGAGGGTGGAGGG - Intergenic
943500819 2:188687440-188687462 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
943564605 2:189503074-189503096 CAGGTCTCCCTGAAGGAAGAGGG - Intergenic
943776223 2:191769305-191769327 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
943911008 2:193567800-193567822 CTGTTCTACTTGAGGGTGGAGGG - Intergenic
943963405 2:194297990-194298012 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
943972816 2:194432570-194432592 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
944058017 2:195543859-195543881 AGGGCCTACTTGAGGGTGGATGG + Intergenic
944085851 2:195847480-195847502 GGGGCCTACTTGAGGGTGGAGGG + Intronic
944269537 2:197765847-197765869 GGGGTCTACTTGAGGGTGGAGGG - Intronic
944277865 2:197860028-197860050 GGGGCCTACCTGAGGGTGGAGGG - Intronic
944404158 2:199362827-199362849 TAGGTATACATGAGGCTGGATGG + Intronic
944622293 2:201528745-201528767 AGGGCCTACTTGAGGGTGGAAGG + Intronic
944774185 2:202945465-202945487 GGGGTCTACTTGAGAGTGGAGGG - Intronic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
945015831 2:205514992-205515014 GGGGTCTATTTGAGGGTGGAAGG - Intronic
945519209 2:210802243-210802265 GGGGGCTACTTGAGGGTGGAGGG - Intergenic
945798587 2:214395682-214395704 AGGGCCTACTTGAGGGTGGAGGG - Intronic
945820331 2:214656769-214656791 GGGGTCTACCAGAAGGTGGAGGG - Intergenic
946587851 2:221210383-221210405 AGGGTCTACCTGAAGGGGGAGGG + Intergenic
946594139 2:221287552-221287574 GGAGTCTACTTGAGGGTGGAGGG + Intergenic
946599311 2:221342074-221342096 TGGGCCTACATGAGGGTGGAGGG + Intergenic
946727449 2:222674604-222674626 GTGGCCTACATGAGGGTGGAGGG - Intronic
947090211 2:226501491-226501513 CGGGTCTACTTGAGTGGGGAGGG - Intergenic
947427841 2:229999862-229999884 GGTGTCTACTTGAGGGTGGAGGG - Intronic
947438441 2:230094249-230094271 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
947477665 2:230465579-230465601 GGGGTCTACTTGAGGATGGAGGG + Intronic
947779355 2:232743564-232743586 GGGGTCTACTTGGGGGTGGAAGG - Intronic
947998537 2:234548399-234548421 CGGGTCTACTTGGGGGTGGAGGG + Intergenic
948043466 2:234923866-234923888 AATGTCTACTTGAGGGTGGAGGG - Intergenic
948118009 2:235507954-235507976 AAGGCCTGCTTGAGGGTGGAGGG - Intronic
948493956 2:238333265-238333287 CAGGCCAACCAGAGGTTGGAGGG - Intronic
948534444 2:238635553-238635575 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
948732674 2:239977046-239977068 CAGCTCTTCCTGTGGCTGGATGG - Intronic
949054618 2:241921059-241921081 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
949084579 2:242140796-242140818 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1169043506 20:2516686-2516708 GAGGTCTAGCTGAGGATGAAAGG + Intronic
1169310354 20:4533026-4533048 GGGGGCTACCTGAGGGTGGAGGG + Intergenic
1169346503 20:4832789-4832811 GGGGCCTACCTGAGGGTGGAGGG + Intergenic
1169514678 20:6303050-6303072 GGGACCTACCTGAGGGTGGAGGG - Intergenic
1169681345 20:8217427-8217449 CATCTCTCCCTGAGGATGGAAGG + Intronic
1170053001 20:12167327-12167349 AGAGTCTACTTGAGGGTGGAGGG - Intergenic
1170075905 20:12418736-12418758 CAGATCTACTTGAGGGAGGAAGG + Intergenic
1170126750 20:12972048-12972070 GGGGCCTACCTGAGGGTGAAGGG - Intergenic
1170247625 20:14240678-14240700 CAGGCCTACTTGAGGGCAGAAGG + Intronic
1170350688 20:15437653-15437675 GGGGTCTACTCGAGGGTGGAGGG - Intronic
1170515408 20:17124434-17124456 AGGGTCTACTTGAGGTTGGAGGG + Intergenic
1170521196 20:17187314-17187336 TGGATCTACTTGAGGGTGGAGGG + Intergenic
1170606474 20:17878543-17878565 CAGGGCTTCCTGACGGTGGTGGG - Intergenic
1170653228 20:18261869-18261891 CGGGTCTACTTGATGGGGGAGGG + Intergenic
1171186876 20:23129111-23129133 GAGGTCTCCCTGAGGGAGGCAGG + Intergenic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1171779093 20:29402518-29402540 GGGGTCTACTTGAGGGGGGAAGG + Intergenic
1171936914 20:31283516-31283538 GGGGCCTATCTGAGGGTGGAGGG + Intergenic
1172217216 20:33244467-33244489 CAGACCTATCTGAGGGTAGAAGG + Intergenic
1172402468 20:34661365-34661387 TGGGCCTACTTGAGGGTGGAGGG - Intronic
1172530846 20:35630406-35630428 CAGACCTGCCTCAGGGTGGATGG + Intronic
1172784366 20:37456953-37456975 GAGGCCTACTTGAGGGTGGAGGG - Intergenic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1173517652 20:43676273-43676295 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1173770345 20:45651069-45651091 GGGGTCTACTTGAGGGTGAAGGG - Intronic
1174779344 20:53374144-53374166 CAGGCCTACTGGAGGGTGAAGGG - Intronic
1175031423 20:55958406-55958428 TAGGTCAAAGTGAGGGTGGAGGG - Intergenic
1175071531 20:56337982-56338004 CAGGTGTACCTGAGAGTGGTGGG + Intergenic
1175259060 20:57663559-57663581 CATGTCTCTTTGAGGGTGGATGG - Intronic
1175935534 20:62512166-62512188 CAGGTCTGGGTGAGGGTGGAGGG + Intergenic
1176179888 20:63744840-63744862 CAGGACATCCTGAGTGTGGAGGG + Exonic
1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG + Intergenic
1176281159 20:64313290-64313312 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1176865636 21:14052967-14052989 AGGATCTACATGAGGGTGGAGGG - Intergenic
1177254202 21:18638303-18638325 GGGGTCTACCTGAGGATTGAAGG + Intergenic
1177309024 21:19362893-19362915 GAGGCCTCCCAGAGGGTGGAGGG - Intergenic
1177531411 21:22363031-22363053 GTTGACTACCTGAGGGTGGATGG + Intergenic
1177544699 21:22541320-22541342 GGGGTCTACATGAGGGTGGAGGG + Intergenic
1177673175 21:24260793-24260815 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
1177718090 21:24866521-24866543 GGGGTCTATCGGAGGGTGGAGGG - Intergenic
1177924367 21:27195616-27195638 GCGGCATACCTGAGGGTGGAGGG + Intergenic
1178200932 21:30404729-30404751 CAGGTCTGCTTGAGGGTGTAAGG - Intronic
1178224883 21:30704775-30704797 GGGGTCTAATTGAGGGTGGAGGG - Intergenic
1179092175 21:38276544-38276566 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1179174509 21:38997958-38997980 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1179262775 21:39773130-39773152 GGGGTCTATCTGAGGGTGGAGGG - Intronic
1179466260 21:41575946-41575968 GGGACCTACCTGAGGGTGGAGGG + Intergenic
1179476900 21:41652571-41652593 GGAGTCTACTTGAGGGTGGACGG - Intergenic
1180935506 22:19622621-19622643 CAGGTGAACTTGAGGGTGAAGGG - Intergenic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181902391 22:26167618-26167640 GAGGCCTACCAGAGGGTGGAAGG + Intergenic
1182263123 22:29090369-29090391 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1182661720 22:31929776-31929798 CTGGTCTACCAGCGGGAGGATGG - Intergenic
1182787994 22:32923846-32923868 GAGGCCTACTTGAGGGTGAAGGG - Intronic
1183217466 22:36490192-36490214 CAGGGGTACCTGAGGATGCAGGG - Exonic
1183598374 22:38825795-38825817 CAGACCTACCTGGGGATGGAGGG - Intronic
1183789113 22:40050597-40050619 CAGTCTTAACTGAGGGTGGATGG - Intronic
1184149430 22:42629675-42629697 CAGGGGTACCTGAGGGTGCTGGG + Intronic
1184156535 22:42671207-42671229 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1184223063 22:43112813-43112835 GAGGCCTACCTGAGCTTGGAGGG + Intronic
1184307242 22:43613599-43613621 GAGACCTACTTGAGGGTGGAGGG + Intronic
1184647620 22:45904677-45904699 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1184966795 22:47981163-47981185 GAGGCCTACCAGAGAGTGGAGGG - Intergenic
1185067682 22:48640250-48640272 CAGCTCTGCTGGAGGGTGGAGGG + Intronic
949270982 3:2216375-2216397 GAGGTCTACTTGAGGGTGGAGGG + Intronic
949376383 3:3394595-3394617 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
949509574 3:4756483-4756505 GAGGTCTACTTGAGGGTGGAGGG - Intronic
950089334 3:10284395-10284417 CATGGCTGTCTGAGGGTGGAGGG + Intronic
950131841 3:10552610-10552632 CAAGTCATCCTGAGGATGGAAGG - Intronic
950482076 3:13250516-13250538 CATGTGAACCTGGGGGTGGAGGG - Intergenic
951070320 3:18320642-18320664 CGGGCCTACTTGAGGGTGGAGGG - Intronic
951259218 3:20486736-20486758 TGGGCCTACCTGAGGGTGGAGGG - Intergenic
951517911 3:23582057-23582079 ATGGCCTACTTGAGGGTGGAGGG - Intronic
951640883 3:24833772-24833794 CAGGTCTACCTGTGGGTATCAGG - Intergenic
951732811 3:25829366-25829388 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
951780909 3:26362057-26362079 AGGGACTACCAGAGGGTGGAGGG - Intergenic
951974578 3:28490657-28490679 GGGGCCTACGTGAGGGTGGAGGG + Intronic
952413503 3:33069960-33069982 GGGGCCTACTTGAGGGTGGAGGG - Intronic
952535691 3:34306631-34306653 GGGGTCTACTTGAGGGTGAAGGG - Intergenic
953008731 3:39003182-39003204 GGGGTCTACTTGAGGATGGAGGG - Intergenic
953122743 3:40061236-40061258 GGGGTCTACTGGAGGGTGGAGGG - Intronic
953491733 3:43358766-43358788 GAGGCCTACCTGAAGGTGAAGGG + Intronic
953667544 3:44936704-44936726 GGGGTCTACCTGAAGGTGGAGGG + Intronic
953727362 3:45411846-45411868 GGGGCCTACCTGAGGGTGGTGGG - Intronic
953907012 3:46873495-46873517 CAGGGCTCCTTGGGGGTGGAGGG - Intronic
954960301 3:54558571-54558593 GGGGCCTACTTGAGGGTGGAGGG - Intronic
955207354 3:56908350-56908372 CTGGTCAAGCTGTGGGTGGAAGG - Intronic
955289191 3:57674963-57674985 GGGGTCTACTTGATGGTGGAGGG + Intronic
955442139 3:58967863-58967885 GGGGTCTACTTGAGGGTGGAGGG - Intronic
955674821 3:61436941-61436963 GAGGCCTACTTGAGGATGGAGGG - Intergenic
955886245 3:63601499-63601521 AGGGTCTACTTGAGAGTGGAGGG - Intronic
956053335 3:65272449-65272471 GCGGTCTACTTGAGGGTGGAGGG + Intergenic
956372386 3:68577421-68577443 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
956447361 3:69338671-69338693 GAGGCCTACTTGAGGGTAGAGGG + Intronic
956943265 3:74189551-74189573 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
957536189 3:81506904-81506926 GGGGCCTACCAGAGGGTGGAGGG + Intronic
957736083 3:84204580-84204602 GAGGCCTACATGAGGGTGAATGG + Intergenic
957746489 3:84349519-84349541 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
957901356 3:86497569-86497591 GGGGTCTACTTGAGGGTAGAGGG + Intergenic
957973978 3:87419831-87419853 CACGTCCAGCTGAGGCTGGAAGG - Intergenic
958055616 3:88407046-88407068 GTGGTCTACTTGAGGGTGGGAGG - Intergenic
958458580 3:94365055-94365077 GAGGTCTTCCTGATGTTGGATGG + Intergenic
958843277 3:99234634-99234656 GAGGTCTACTTGAGGGTAGAGGG - Intergenic
959098334 3:101981837-101981859 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
959098439 3:101983016-101983038 GGGGTTTACTTGAGGGTGGAAGG - Intergenic
959188124 3:103073339-103073361 GAGGCCTACTTGAGGGTGGAAGG - Intergenic
959296210 3:104537611-104537633 GAGGCCTATTTGAGGGTGGAGGG + Intergenic
959430838 3:106252907-106252929 GAGGCCTACCTGAGGGTAAAGGG + Intergenic
959519641 3:107310642-107310664 GGGGCCTACGTGAGGGTGGAGGG - Intergenic
959610593 3:108290494-108290516 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
960089838 3:113628019-113628041 CAAGTCTCCGTGAGGGTGGGAGG - Exonic
960257498 3:115526558-115526580 GCTGTCTACCAGAGGGTGGAGGG - Intergenic
960342625 3:116493097-116493119 GGGGCCTACTTGAGGGTGGAGGG + Intronic
960782681 3:121337084-121337106 GGGGTCTACTTGAGGGTGGTGGG + Intronic
961417191 3:126767749-126767771 GGGGCCTACTTGAGGGTGGAAGG - Intronic
961643634 3:128380845-128380867 CATGTGCACCTGTGGGTGGAGGG + Intronic
962036215 3:131654400-131654422 GGGGCCTACCTGAGGGTAGAGGG - Intronic
962073904 3:132060213-132060235 GGGGTCTACTTGAGAGTGGAGGG - Intronic
962123542 3:132589868-132589890 GAGGTCTGCTTGAGGGTGGAGGG - Intronic
962506657 3:136053118-136053140 GCGGTCTACTTGAGGGTGGAAGG + Intronic
962691676 3:137905407-137905429 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
962695461 3:137943277-137943299 GGGGCCTACCTGAGGGTGGAGGG - Intergenic
962860977 3:139401188-139401210 GAGGTCTACGTGAGGATGGAGGG - Intergenic
962881884 3:139586212-139586234 GGGGTCTACTTGAGGGTGGAGGG + Intronic
963035037 3:141018813-141018835 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
963279192 3:143365265-143365287 GGGGCCTACCTGAGGGTGGAAGG + Intronic
963393224 3:144696572-144696594 CAATTCCACTTGAGGGTGGAAGG - Intergenic
963674401 3:148290946-148290968 GGGGTCTCCTTGAGGGTGGAGGG + Intergenic
963831204 3:150011604-150011626 GGGGCCTACTTGAGGGTGGAGGG + Intronic
963979780 3:151524616-151524638 GTGGTCTACTTGAGTGTGGAGGG + Intergenic
963993844 3:151684265-151684287 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
964177463 3:153841456-153841478 GGGATCTACTTGAGGGTGGAGGG - Intergenic
964244862 3:154639854-154639876 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
964255363 3:154769064-154769086 GGGGTCTATTTGAGGGTGGAAGG - Intergenic
964529864 3:157655852-157655874 GGGGTCTACTTGAGGGTGGAGGG - Intronic
965065824 3:163847355-163847377 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
965182383 3:165420785-165420807 GGGGCCTACCGGAGGGTGGAGGG + Intergenic
965193264 3:165559429-165559451 AGAGTCTACTTGAGGGTGGAGGG - Intergenic
965293357 3:166912401-166912423 GAGGTCTTCTTGAGGTTGGATGG - Intergenic
965563231 3:170081727-170081749 GGGGTCTACTTGAGGGAGGAGGG - Intronic
965632433 3:170747046-170747068 CAGGTCTAGCTGAAGTTGGTAGG - Intronic
965742239 3:171887670-171887692 GGTGTCTACTTGAGGGTGGAGGG - Intronic
966042024 3:175503084-175503106 AAGGCCTACTTGAGGGTAGATGG - Intronic
966228619 3:177625969-177625991 GGGGCCTACCGGAGGGTGGAGGG - Intergenic
966453538 3:180089842-180089864 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
966663494 3:182444002-182444024 GAGGCCTACTTGAGGATGGAGGG + Intergenic
966671778 3:182535329-182535351 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
966722178 3:183074870-183074892 GGGGTCTACCTGAGTGGGGAAGG - Intronic
966774125 3:183529136-183529158 GAGGCCTACCGGAGGGTAGAGGG + Intronic
966778682 3:183564882-183564904 CAGGTCACCCTGAGGCTGGGTGG + Intergenic
966818347 3:183906787-183906809 AGGGTCTACCTGAGGGTAGAGGG + Intergenic
966833200 3:184028863-184028885 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
967010685 3:185430453-185430475 GGGGCCTACGTGAGGGTGGAGGG - Intronic
967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG + Intronic
967287601 3:187888653-187888675 TGGGCCTACCTGAGGGTGAAGGG - Intergenic
967374314 3:188783543-188783565 GGGATCTACTTGAGGGTGGAGGG + Intronic
967439153 3:189486800-189486822 GAAGTCTACTTGAGGGTGGAGGG - Intergenic
967744994 3:193045378-193045400 GGGGCCTACCTGAGGGTGGAGGG + Intergenic
967978556 3:195049783-195049805 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
968287892 3:197518886-197518908 GAGGTCAGCCTGAGGGGGGATGG - Intronic
968436007 4:589722-589744 CCCGTCTTCCTGAGGCTGGAAGG - Intergenic
969346181 4:6571537-6571559 TGGGTCTAGCTGAGGGTGAAAGG + Intergenic
969782575 4:9420568-9420590 AAGGCCTACCTGGGGATGGAGGG + Intergenic
970010430 4:11452910-11452932 GGGTTCTACTTGAGGGTGGAGGG - Intergenic
970012727 4:11477961-11477983 AGGGTCTACTTGAGAGTGGATGG + Intergenic
970375174 4:15450012-15450034 GGGGTCTACTTGAGGGTGGAAGG + Intergenic
970723372 4:19014183-19014205 CAAGTTTACCTGGGGGAGGAAGG + Intergenic
971106487 4:23530356-23530378 AGGGTCTACTTGAAGGTGGAGGG + Intergenic
971461728 4:26906263-26906285 TGGGTCAACTTGAGGGTGGAGGG + Intronic
971521151 4:27552069-27552091 GGGATCTACTTGAGGGTGGAGGG - Intergenic
971691452 4:29841695-29841717 GGGGCCTACCTGAGGGTGGTGGG + Intergenic
972010657 4:34176969-34176991 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
972125912 4:35765422-35765444 AAGACCTACTTGAGGGTGGAGGG - Intergenic
972143380 4:35989670-35989692 AGGGTCTACTTGAGGGTGAAGGG + Intronic
972724644 4:41736099-41736121 AGGGCCTACCTGAGGGTGGAGGG - Intergenic
973091024 4:46136791-46136813 AAGGTCTACTTAAGGTTGGAGGG + Intergenic
973116009 4:46460206-46460228 GGGGCCTGCCTGAGGGTGGAGGG - Intronic
973221933 4:47736636-47736658 GGGGTCTACCAGAAGGTGGAGGG - Intronic
973224839 4:47771595-47771617 GGGGTCTATCAGAGGGTGGAGGG - Intronic
973289077 4:48452353-48452375 TAGTTCTACTTGAGAGTGGAGGG + Intergenic
973566048 4:52188657-52188679 CAGGGCTACCTGAGGGCAGAGGG - Intergenic
973674847 4:53254081-53254103 GGGGCCTACCTGAGGGTGGAGGG + Intronic
973702277 4:53549005-53549027 GGGGTCTACTTGAAGGTGGAGGG + Intronic
973743603 4:53942052-53942074 GGGGTCTACTGGAGGGTGGAGGG + Intronic
974063876 4:57059583-57059605 TGGGTCTACTTGAGGGTGGAGGG + Intronic
974065318 4:57072150-57072172 GGGGTCTACCTGACAGTGGAGGG - Intronic
974123055 4:57663161-57663183 GGGGTCCACTTGAGGGTGGAGGG - Intergenic
974155635 4:58068701-58068723 GCGGCCTACTTGAGGGTGGAAGG + Intergenic
974159848 4:58124516-58124538 AACGTCTACTTGAGGGTGGAGGG + Intergenic
974198292 4:58605186-58605208 GCGGTCTACTTGAAGGTGGAAGG - Intergenic
974239766 4:59231669-59231691 GGGGCCTACCTGAGGGTGGACGG - Intergenic
974281581 4:59801908-59801930 GGGGCCTATCTGAGGGTGGAGGG + Intergenic
974623754 4:64395827-64395849 GGGGCCTACTTGAGGGTGGAGGG - Intronic
974749723 4:66121729-66121751 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
974765993 4:66347265-66347287 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
974944193 4:68506184-68506206 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
974954741 4:68623497-68623519 GGGGTCTACTTGAGGGTGGAGGG + Intronic
975031374 4:69621995-69622017 AAGGCCTACTTGAGGGTGGATGG + Intronic
975511999 4:75204341-75204363 GGGCTCTACCAGAGGGTGGAGGG + Intergenic
975598025 4:76068615-76068637 GGGGCCTACTTGAGGGTGGAGGG + Intronic
975904276 4:79190824-79190846 GAGGTCTACTTGAGGGTGGAGGG - Intergenic
975927599 4:79477239-79477261 GTGGTCTTCCTGAAGGTGGAGGG - Intergenic
976001813 4:80383169-80383191 AGGGCCTACTTGAGGGTGGAGGG + Intronic
976015839 4:80553154-80553176 GGGGTCTACTTGAGGGTGGAGGG - Intronic
976043042 4:80910661-80910683 AGGGGCTACCTGAGGGTAGAGGG + Intronic
976045064 4:80936624-80936646 GAGACCTACCTGAGGGTGGAGGG + Intronic
976346266 4:84005218-84005240 CAGGCCTTTCAGAGGGTGGAGGG + Intergenic
976393915 4:84535320-84535342 GGGATCTACCTGAGAGTGGAAGG + Intergenic
976640215 4:87329918-87329940 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
976687447 4:87830567-87830589 GGGGTCTACTTGAGGGTGAAGGG + Intronic
976815567 4:89144649-89144671 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
977278669 4:95011241-95011263 GGGGTCTACCTGAGGGTGGAGGG - Intronic
977412309 4:96683580-96683602 AGGGCCTACTTGAGGGTGGAAGG - Intergenic
977445799 4:97130434-97130456 AAGGCCTACTTGAGGGTGGAAGG + Intergenic
977508182 4:97929036-97929058 TGGGTCTACTTGAGGGTGGAGGG - Intronic
977517314 4:98036643-98036665 GAGGTCTTTCAGAGGGTGGAGGG + Intronic
977738475 4:100446743-100446765 GGGGTCTACCTGAGGGTGGAGGG - Intronic
978287051 4:107091827-107091849 GGGGCCTACTTGAGGGTGGAGGG + Intronic
978390847 4:108223675-108223697 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
978491005 4:109312307-109312329 GAGGCCTACTAGAGGGTGGAGGG - Intergenic
978558111 4:110002816-110002838 GGGGGCTACCTGAGGGTGGAGGG - Intronic
978593259 4:110349708-110349730 GGTGTCTACTTGAGGGTGGAGGG - Intergenic
978716171 4:111845845-111845867 GGGGTCTATCAGAGGGTGGAGGG + Intergenic
979012020 4:115384134-115384156 CAGGTCTACCTGATGGTGAAGGG - Intergenic
979045667 4:115859567-115859589 GTGGTCTACTTGAGGGTGAAAGG + Intergenic
979158820 4:117431881-117431903 GCGGACTACTTGAGGGTGGAGGG + Intergenic
979224554 4:118269434-118269456 TGGGCCTACCTGAGGGCGGAGGG - Intergenic
979262009 4:118659028-118659050 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
979281908 4:118878194-118878216 AGGGCCTACTTGAGGGTGGAGGG + Intronic
979367044 4:119837751-119837773 TGGGTCTACTTGAGGGTGCAAGG - Intergenic
979590600 4:122475262-122475284 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
979741930 4:124161794-124161816 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
979780324 4:124643924-124643946 GGAGTCTACTTGAGGGTGGAGGG + Intergenic
979842432 4:125460437-125460459 GGGGTCTACTGGAGGGTGGAGGG - Intronic
979861530 4:125699314-125699336 GAGGGCTACTTGAGGGTGGAGGG + Intergenic
979879121 4:125931738-125931760 GTGGTCTACTTGAGGGTGAAGGG - Intergenic
980005118 4:127532809-127532831 GGAGTCTACTTGAGGGTGGAAGG - Intergenic
980089596 4:128428582-128428604 TGGGCCTACTTGAGGGTGGAGGG - Intergenic
980398205 4:132243664-132243686 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
980447782 4:132933429-132933451 AGGGCCTACTTGAGGGTGGATGG + Intergenic
981253720 4:142635695-142635717 TGGGTCTACTTGAGGGTGGAGGG + Intronic
981495865 4:145391555-145391577 GGGTTCTACTTGAGGGTGGAGGG + Intergenic
981512449 4:145572677-145572699 GGGGCCTACCTGAGGGTGGGGGG + Intergenic
981655475 4:147107867-147107889 CGGGCCTACCAGAGGTTGGAGGG + Intergenic
981721301 4:147804156-147804178 GGGGGCTACTTGAGGGTGGAGGG - Intronic
981739898 4:147990760-147990782 GAGGTCTACTTGAGGGACGAGGG + Intronic
982219111 4:153110022-153110044 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
982420772 4:155194401-155194423 GAGGCCTACTTGAGGATGGAGGG - Intergenic
982633953 4:157868503-157868525 GGGGCCTACCTGAGGGTGGAGGG - Intergenic
982641198 4:157963845-157963867 GGGGTCTACATGAGGGTGAAGGG + Intergenic
982677341 4:158390849-158390871 GAAGCCTAACTGAGGGTGGAGGG + Intronic
982690517 4:158542946-158542968 GGGGCCTACTTGAGGGTGGAGGG + Intronic
983447286 4:167869496-167869518 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
984023574 4:174516473-174516495 AAGGTCTACTTGAGGATGAAGGG + Intronic
984027897 4:174567083-174567105 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
984240140 4:177208580-177208602 AAGGCCTACTTCAGGGTGGAGGG - Intergenic
984278266 4:177636403-177636425 GCGATCTACCTGAGGGTGGAGGG - Intergenic
984476851 4:180246072-180246094 GGGGCCTATCTGAGGGTGGAGGG + Intergenic
984829572 4:183959312-183959334 AAGGTCTAACTCAGGGCGGAAGG + Intronic
984861962 4:184248710-184248732 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
984946952 4:184976344-184976366 GAGGTCTACTTGAAGGGGGAGGG - Intergenic
985324150 4:188748715-188748737 CGGGTCTACTTGAGGGGGGAAGG - Intergenic
985443967 4:190009386-190009408 GGGGTCTACCTGAGCGGGGAAGG + Intergenic
985469122 5:26891-26913 GGGGTCTACTTGAGGGGGGAGGG - Intergenic
985831566 5:2237570-2237592 GGGGTCTACCTGAGAGGGGAGGG + Intergenic
985845289 5:2340320-2340342 GGGGACTACCTGAGGGTGGAGGG - Intergenic
986054323 5:4120881-4120903 GAGGTCTACCAGAGGGTGGATGG + Intergenic
986353146 5:6898917-6898939 GGGGTCTAGTTGAGGGTGGAGGG + Intergenic
986520931 5:8617301-8617323 CAGACCTAATTGAGGGTGGAGGG - Intergenic
986823585 5:11496548-11496570 CACTCCTACCTTAGGGTGGAGGG - Intronic
987013336 5:13790907-13790929 GGGGTCTACCTGAGGGTGGAAGG + Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987400951 5:17476146-17476168 GGGGCCTACCTGTGGGTGGAGGG + Intergenic
987643628 5:20643343-20643365 GGGGCCTAACTGAGGGTGGAAGG + Intergenic
987661138 5:20877838-20877860 AAGGCCTACTTGAGGTTGGAGGG + Intergenic
987756722 5:22106117-22106139 GGGTTCTACTTGAGGGTGGAGGG + Intronic
988043789 5:25921506-25921528 AGGGTCTCCTTGAGGGTGGAGGG + Intergenic
988209069 5:28179060-28179082 GGGGCCTATCTGAGGGTGGATGG + Intergenic
988974489 5:36501513-36501535 GAGGTCTACTTGAGGGTGGAGGG + Intergenic
989161057 5:38392109-38392131 GGGGTCTACCTGAGGATGGAGGG - Intronic
989312303 5:40034280-40034302 TGGGCCTACTTGAGGGTGGAAGG + Intergenic
989370870 5:40706315-40706337 GGGGTCTACCTGAGTGGGGAGGG + Intergenic
989509538 5:42268946-42268968 ATGGCCTACCTGAGGGTGAAGGG + Intergenic
989618424 5:43360424-43360446 GGGGCCTACCTGAGGGTGGAGGG - Intergenic
989738972 5:44746783-44746805 CAGGTCTACTTGAGGGTTAAGGG - Intergenic
989760457 5:45009570-45009592 GGGGCCTACCTGAGAGTGGAGGG + Intergenic
989794669 5:45452559-45452581 GAGGCCTACTTGAGGGTGGAGGG - Intronic
990024502 5:51168907-51168929 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
990106552 5:52270606-52270628 GTGGTCTACTTGAGGGTGGGAGG + Intergenic
990134098 5:52624298-52624320 AGAGTCTACTTGAGGGTGGAGGG - Intergenic
990348710 5:54894411-54894433 GGGGCCTACCTGAGGGTGGAGGG + Intergenic
990354078 5:54948498-54948520 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
990568656 5:57055552-57055574 CATCTCTACCTGGGGGTGGAAGG - Intergenic
990687059 5:58316398-58316420 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
990734059 5:58840975-58840997 CAGGTCTACATGCAGGTGCAAGG + Intronic
990797056 5:59555332-59555354 GGGGCCTACCAGAGGGTGGAGGG + Intronic
990898211 5:60722660-60722682 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
990998777 5:61761082-61761104 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
991390911 5:66142666-66142688 GTGGTCTACTTGAGGGTGGAGGG - Intronic
992309348 5:75479450-75479472 GGGGTCTACTTGAGGGTAGAGGG - Intronic
992593317 5:78318685-78318707 GAGGCCTCCTTGAGGGTGGAGGG + Intergenic
992919899 5:81503972-81503994 GGGGCCTACTTGAGGGTGGAAGG + Intronic
992976209 5:82123354-82123376 GGGTTCTACTTGAGGGTGGAGGG + Intronic
993062409 5:83054672-83054694 GGGGCCTACTTGAGGGTGGAGGG + Exonic
993139690 5:84016045-84016067 TGGGTCTACTTGAGGGTGGGTGG - Intronic
993275895 5:85858212-85858234 GGGGTCTACCTGAGGGTAGAGGG + Intergenic
993278638 5:85896222-85896244 GAGGCTTACTTGAGGGTGGATGG - Intergenic
993762499 5:91813379-91813401 GAGGCCTACTTGAGGGTGGATGG + Intergenic
993795135 5:92257635-92257657 GGGGCCTACCTGAAGGTGGAGGG + Intergenic
993801423 5:92347626-92347648 GGGATCTACTTGAGGGTGGAGGG - Intergenic
993894852 5:93522193-93522215 GGGGTCTACCTGAGGGTGGAGGG + Intergenic
993959167 5:94275738-94275760 AAGGACTACCTGAGGGAGCAAGG - Intronic
994228412 5:97282773-97282795 AGAGTCTACTTGAGGGTGGAGGG - Intergenic
994242990 5:97446104-97446126 AGGTTCTACTTGAGGGTGGAGGG + Intergenic
994260472 5:97652712-97652734 ATGGCCTACCTGATGGTGGAGGG - Intergenic
994348260 5:98714341-98714363 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
994412845 5:99431269-99431291 GGGGTCTATTTGAGGGTGGAGGG - Intergenic
994467417 5:100155618-100155640 GGGGTCTACTTGAGGGAGGAGGG - Intergenic
994480996 5:100334451-100334473 GGGGTCTATTTGAGGGTGGAGGG + Intergenic
994590498 5:101766553-101766575 TGGGCCTACTTGAGGGTGGAGGG - Intergenic
994642597 5:102428654-102428676 GGAGCCTACCTGAGGGTGGAGGG - Intronic
994679845 5:102872906-102872928 GGGGCCTACTTGAGGGTGGAGGG + Intronic
994765100 5:103905506-103905528 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
994918458 5:106010218-106010240 CATGCGTACTTGAGGGTGGAGGG + Intergenic
994940635 5:106319229-106319251 GGAGTCTACATGAGGGTGGAGGG + Intergenic
995013018 5:107278750-107278772 GGGGACTACTTGAGGGTGGAGGG - Intergenic
995099948 5:108288099-108288121 AGGGCCTACTTGAGGGTGGAAGG + Intronic
995170625 5:109107485-109107507 GGGGTCTACTTGAGGGTAGAGGG - Intronic
995622675 5:114043919-114043941 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
995653373 5:114396877-114396899 AGGGCCTACCTGAGGGTAGAGGG - Intronic
995717978 5:115099175-115099197 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
995778613 5:115752179-115752201 AAGGCCTACTTGAGAGTGGAGGG - Intergenic
995943248 5:117610594-117610616 AGGGCCTACCTGAGGGTGGAGGG - Intergenic
996053645 5:118960912-118960934 GAGGCCTAATTGAGGGTGGAGGG + Intronic
996081117 5:119259282-119259304 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
996160025 5:120149754-120149776 GGGGCCTACCTGAGGGTGAAGGG + Intergenic
996180580 5:120414355-120414377 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
996288381 5:121822824-121822846 GTGGACTACCAGAGGGTGGAGGG - Intergenic
996850450 5:127945780-127945802 AAGGCTTACTTGAGGGTGGAGGG - Intergenic
996953812 5:129159730-129159752 GCAGCCTACCTGAGGGTGGAGGG - Intergenic
997053109 5:130406594-130406616 GGGGCCTACCTGAGGATGGATGG - Intergenic
997066195 5:130562335-130562357 TGGGTCTACTTGAGGATGGAGGG + Intergenic
997099733 5:130955921-130955943 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
997263492 5:132481225-132481247 CAGGAATGTCTGAGGGTGGAAGG - Intergenic
997587015 5:135049220-135049242 CAGGCCCACCAGAGAGTGGAAGG - Intronic
997609465 5:135204811-135204833 GGGGTCTACTTGAGGGTGGAGGG - Intronic
997641858 5:135454509-135454531 GGGGTCTACTTGAGGGTGGGGGG - Intergenic
997789029 5:136739781-136739803 GAGGTGTACTTGAGAGTGGAGGG + Intergenic
997790903 5:136761185-136761207 GAGGCCTACTTGAGGGTGGAGGG + Intergenic
998040723 5:138949463-138949485 CAGAGCTGCCTGAAGGTGGAGGG - Intronic
998494421 5:142575010-142575032 GAGGTTTACTTGAGGATGGAAGG - Intergenic
998594837 5:143517839-143517861 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
998776064 5:145604247-145604269 AGGGCCTACTTGAGGGTGGAGGG - Intronic
999056040 5:148577806-148577828 GGGGTCTACTTGAGGGTGGAGGG + Intronic
999567376 5:152879818-152879840 CGGGCCTGCTTGAGGGTGGAGGG + Intergenic
999593665 5:153177847-153177869 GGGGCCTACCTGAGGGTGGAGGG + Intergenic
999686939 5:154111570-154111592 GAGGATTACCTGAGGCTGGAAGG + Intronic
999834709 5:155356809-155356831 GGGGACTACCTGAGGGTGAAGGG + Intergenic
999916459 5:156267989-156268011 GGGGTCTACGTGAGGGTGGAGGG - Intronic
1000162717 5:158615499-158615521 AGGGTCTACTTGTGGGTGGAGGG - Intergenic
1000165631 5:158645796-158645818 GGGGCTTACCTGAGGGTGGAGGG + Intergenic
1000276493 5:159740816-159740838 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1000629829 5:163579720-163579742 AGGGCCTACTTGAGGGTGGATGG - Intergenic
1000658192 5:163907416-163907438 GGGGCCTACCTGAGGTTGGAAGG - Intergenic
1000678441 5:164152919-164152941 AGGATCTACTTGAGGGTGGAGGG + Intergenic
1000731901 5:164845190-164845212 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1000734252 5:164879390-164879412 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
1000779040 5:165456540-165456562 GGGGCCTACCTGAGGGTGAAGGG - Intergenic
1001850971 5:174964832-174964854 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1002624815 5:180518606-180518628 CAGGACTACCTGAGCCTGGGAGG - Intronic
1002667835 5:180839599-180839621 GAGGCCTACTTGAGGGTGAAGGG + Intergenic
1002732576 5:181352146-181352168 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1002751961 6:121961-121983 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1002880655 6:1248979-1249001 GGGGGCTACTTGAGGGTGGAGGG - Intergenic
1003436819 6:6097834-6097856 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
1004034079 6:11904933-11904955 GGGATCTACTTGAGGGTGGAGGG - Intergenic
1004059368 6:12177152-12177174 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1004108370 6:12688293-12688315 CTGGCCTACTTGAGGCTGGAGGG + Intergenic
1004818062 6:19333854-19333876 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1004885074 6:20043358-20043380 GGGGCTTACCTGAGGGTGGAGGG - Intergenic
1005102075 6:22182101-22182123 GGGGTCTACTTGAGGGTAGAGGG - Intergenic
1005687198 6:28266057-28266079 AAGGACTTCTTGAGGGTGGAGGG - Intergenic
1005768317 6:29037380-29037402 TGGGCCTACCTGAGGGTGGCAGG - Intergenic
1005775167 6:29123460-29123482 GGGGTCTACTTGACGGTGGAGGG + Intergenic
1005781229 6:29194696-29194718 GGGGTCTACTTGACGGTGGAGGG + Intergenic
1005785112 6:29237005-29237027 CAGATTTTCTTGAGGGTGGAAGG - Intergenic
1005902524 6:30229594-30229616 GAGGTCTATTTGAGGATGGAGGG - Intergenic
1006044367 6:31281799-31281821 GGGGTCCACTTGAGGGTGGAGGG + Intronic
1006053422 6:31361621-31361643 GGGGTCCACTTGAGGGTGGAGGG + Intergenic
1007123059 6:39399697-39399719 CAGGCCTGCCTGAGGGTGTGTGG + Intronic
1007216245 6:40241519-40241541 TGGATCTACTTGAGGGTGGAGGG + Intergenic
1007502449 6:42308773-42308795 GAGGTCTACTTGAGGGGGGAGGG + Intronic
1007936149 6:45733791-45733813 GAGGTCTACTTGTGGGTGGAGGG - Intergenic
1008191123 6:48459404-48459426 GGGGTCTACTGGAGGGTGGAGGG - Intergenic
1008298044 6:49802479-49802501 GAGGCCTACTTAAGGGTGGAGGG - Intergenic
1008611675 6:53190116-53190138 GGGGTGTACTTGAGGGTGGAAGG - Intergenic
1008736666 6:54552945-54552967 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1008779528 6:55086211-55086233 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1008821888 6:55642793-55642815 GAGGCCTACTTGAGGGTGGAAGG - Intergenic
1009509105 6:64525510-64525532 GGGGACTACTTGAGGGTGGAGGG + Intronic
1009656474 6:66552561-66552583 AAGGTCTCCATGAGGGTGGAGGG + Intergenic
1009753626 6:67905118-67905140 GGGGTCTACTTGAGGGGGGAGGG + Intergenic
1009764157 6:68047737-68047759 GTGGTCTACTTGAGGGTGGAAGG + Intergenic
1010187417 6:73159335-73159357 GAGGCCTACTTGAGGGTGGATGG + Intronic
1010193503 6:73217189-73217211 AAGTTCTACTTGAGGGTGGAGGG + Intronic
1010195198 6:73232640-73232662 GCGGTCTACTTGAGGGTGGAGGG + Intronic
1010390755 6:75334412-75334434 CAGGTTTTACTGAGTGTGGATGG - Intronic
1010466408 6:76171767-76171789 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1010523518 6:76872232-76872254 GGGTTCTACTTGAGGGTGGAGGG - Intergenic
1010771338 6:79835013-79835035 GGGGTCTACAAGAGGGTGGAGGG + Intergenic
1010802102 6:80188343-80188365 GGGATCTACCTGAGGGTGGAGGG + Intronic
1010899419 6:81407877-81407899 GGGATCTACTTGAGGGTGGAAGG - Intergenic
1010914665 6:81601124-81601146 GGGGTATACTTGAGGGTGGAAGG + Intronic
1011253561 6:85398757-85398779 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
1011257031 6:85433002-85433024 AGGGTCTACTTGAGGGTGGAAGG - Intergenic
1011314145 6:86012667-86012689 CAGGCCTACTTGAGGGTGGAGGG - Intergenic
1011970846 6:93220731-93220753 GGGGCCTTCCTGAGGGTGGAGGG + Intergenic
1012141137 6:95628378-95628400 GAGGTCTACTTGAGGGTGCAGGG + Intergenic
1012337472 6:98078971-98078993 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1012577146 6:100816741-100816763 GGGGCCTACCTGAGGGTAGAGGG + Intronic
1012591449 6:100985993-100986015 GGGGTCTACTTGAGGGTGAAGGG + Intergenic
1012761723 6:103310519-103310541 CTGATCTACCTGAAGCTGGAGGG - Intergenic
1012991809 6:105933829-105933851 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1013314793 6:108931076-108931098 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1013390045 6:109677078-109677100 AAGGCCTACTTGAGGGTAGAGGG + Intronic
1013766433 6:113579350-113579372 GGGGTCTACTTGAGGGTTGAGGG + Intergenic
1013848517 6:114484766-114484788 GGGGCCTACCAGAGGGTGGAGGG + Intergenic
1014029622 6:116685438-116685460 GGGGCCTACCGGAGGGTGGAGGG - Intronic
1014075450 6:117229868-117229890 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1014124891 6:117765532-117765554 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1014207345 6:118670383-118670405 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1014244301 6:119050980-119051002 GGGGCCTACCTGAGAGTGGAGGG + Intronic
1014276398 6:119394755-119394777 CAGGTCTACCTAAGGGTCCCCGG + Intergenic
1014402390 6:121006645-121006667 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
1014613767 6:123577300-123577322 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1014961207 6:127687478-127687500 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1015474027 6:133638830-133638852 GGGGCCTACTTGAGGGTGGAAGG - Intergenic
1015567678 6:134590435-134590457 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1015697637 6:135999419-135999441 GGGGCCTACTTGAGGGTGGAAGG - Intronic
1015931102 6:138360535-138360557 TGGGCCTACTTGAGGGTGGAGGG - Intergenic
1016235904 6:141865887-141865909 GAAGTCTATTTGAGGGTGGAGGG + Intergenic
1016298573 6:142602978-142603000 GGGGTCTACTTAAGGGTGGAGGG - Intergenic
1016402762 6:143698676-143698698 CAGGTCTACGTTTGGGTGGATGG + Intronic
1016777937 6:147925836-147925858 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1017370931 6:153707572-153707594 GGGGTCTACCTGAGGGTGAAGGG - Intergenic
1017547087 6:155464205-155464227 AAGGCATACTTGAGGGTGGAAGG - Intergenic
1017611641 6:156193049-156193071 GGGGCCTACCTGAGGGAGGAGGG - Intergenic
1017762066 6:157577016-157577038 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1018001445 6:159582007-159582029 GGGGTCTACCTGAGGGTAGAGGG + Intergenic
1018356553 6:163023227-163023249 GAGGACTACTGGAGGGTGGAAGG - Intronic
1018389383 6:163330856-163330878 CAGGGCTACTTTAGGGCGGAGGG - Intergenic
1018671629 6:166182546-166182568 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
1018762722 6:166905557-166905579 CAGGTCTCCCTGAAGAGGGATGG + Intronic
1019099325 6:169615379-169615401 GGGGTCTGCTTGAGGGTGGAGGG - Intronic
1019236831 6:170624464-170624486 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1019401410 7:856219-856241 CAGATCTGCCTGTGGGTGGCAGG - Intronic
1019793238 7:3031048-3031070 GGGGCCTCCCTGAGGGTGGAGGG - Intronic
1020706625 7:11552147-11552169 AGGGCCTACCTGAGGGTGTAAGG + Intronic
1020817000 7:12917829-12917851 GTGGCCTACTTGAGGGTGGATGG - Intergenic
1020861368 7:13495991-13496013 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1020985943 7:15134455-15134477 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1021426188 7:20502313-20502335 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1021500261 7:21324830-21324852 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1021611972 7:22466376-22466398 GTGGCCTACTTGAGGGTGGAGGG - Intronic
1021618481 7:22527092-22527114 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1021648313 7:22808237-22808259 CAGTTCTCCCTGAGGGTCGAGGG - Intergenic
1021833595 7:24644260-24644282 GGGGTCTACCTGAGTGGGGAGGG - Intronic
1022228737 7:28392111-28392133 GGGGCCTACCTGAGGGTGGACGG + Intronic
1022597025 7:31722562-31722584 CTGACCTATCTGAGGGTGGATGG + Intergenic
1022694896 7:32695027-32695049 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1022928076 7:35076545-35076567 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1023406364 7:39837334-39837356 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1023505444 7:40895299-40895321 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1023571333 7:41575601-41575623 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1024254591 7:47531094-47531116 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1024313376 7:47990937-47990959 GAGATCTACTTGAGGGTGGGGGG + Intronic
1024355353 7:48408847-48408869 GAGGTCTACCAGATGGTGGAGGG - Intronic
1024456078 7:49608611-49608633 TGGGCCTACCTGAGAGTGGAGGG - Intergenic
1024726282 7:52200026-52200048 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1025775545 7:64557845-64557867 CAGGCCTAGTTGAGGGTGGTGGG + Intronic
1025789223 7:64672108-64672130 GAGGCCTAGCTGAGGGTGGAAGG - Intronic
1026115501 7:67492303-67492325 GAGGCCTACTGGAGGGTGGAGGG - Intergenic
1026116532 7:67500445-67500467 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1026422160 7:70250852-70250874 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1026431081 7:70347810-70347832 CAAGTCTCCCAGAGGGTAGAAGG - Intronic
1027429678 7:78097651-78097673 GGTGTCTACTTGAGGGTGGAGGG + Intronic
1027476092 7:78633230-78633252 GGGGTCTACTTGAGGGCGGAAGG + Intronic
1027875361 7:83761626-83761648 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1027956359 7:84883569-84883591 GGGGCCTATCTGAGGGTGGAGGG - Intergenic
1027957143 7:84895122-84895144 GGGGTCTACATGAGGGTGGAGGG - Intergenic
1028176450 7:87665693-87665715 GAGGTCTACTTGAGAGTGAAGGG - Intronic
1028233048 7:88328731-88328753 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1028323642 7:89494925-89494947 GTGGCCTACTTGAGGGTGGAAGG + Intergenic
1028444922 7:90910935-90910957 GTGGCCTACCAGAGGGTGGAGGG - Intronic
1028615130 7:92757306-92757328 GGAGTCTACTTGAGGGTGGAAGG - Intronic
1028640372 7:93035733-93035755 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1028757972 7:94459795-94459817 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1028913392 7:96232423-96232445 ACGGCCTACCAGAGGGTGGAGGG + Intronic
1029195151 7:98800285-98800307 GGAGTCTACTTGAGGGTGGAGGG - Intergenic
1029250109 7:99230097-99230119 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
1029365156 7:100111991-100112013 CAGGGCTTCCTGTGGGAGGAGGG + Exonic
1029901389 7:104044054-104044076 ATGGCCTACCTGAGGGTGGAGGG + Intergenic
1029932549 7:104387944-104387966 GGGGCCTACTTGAGGGTGGAAGG - Intronic
1029939023 7:104460011-104460033 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1030168858 7:106581663-106581685 CTGGTCTACTTGAAGATGGAGGG + Intergenic
1030374537 7:108739773-108739795 GGGGTCCACCAGAGGGTGGAGGG - Intergenic
1031023880 7:116659273-116659295 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1031097585 7:117439879-117439901 CAAGCCTACTTGAGGGTGGAGGG - Intergenic
1031294888 7:119989119-119989141 CGGGTCTACTTGAGGTTGGAGGG + Intergenic
1031405468 7:121380537-121380559 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1031602681 7:123730952-123730974 CAGGCCTACTTGAGGGTGGGGGG - Intronic
1031703204 7:124950804-124950826 GAGGCCTACCTGCGGATGGAGGG + Intergenic
1031911641 7:127523048-127523070 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1032371938 7:131364631-131364653 TGGGACTACTTGAGGGTGGAGGG - Intronic
1032960937 7:137033332-137033354 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1033292573 7:140100052-140100074 CAGGGCTACCTGAGGGTGGATGG - Intronic
1033320597 7:140336097-140336119 CAGGTCTACCTGAGAGAGTCTGG - Intronic
1033807105 7:144966966-144966988 GAGGCCTACTTGAGGGTGAAGGG + Intergenic
1033922403 7:146410650-146410672 CAAGTCTATCAGAGGGTAGAGGG - Intronic
1034043993 7:147908284-147908306 CACGTCTCCCTGAGGGATGATGG - Intronic
1034359193 7:150479151-150479173 AGGGTATACTTGAGGGTGGAGGG + Exonic
1035510941 8:182146-182168 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1036055050 8:5242631-5242653 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1036440660 8:8778893-8778915 CATGTGTATCTGAGCGTGGAAGG - Intergenic
1036490061 8:9216684-9216706 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1036798001 8:11769802-11769824 CAGATCTACCGGAGGGCGGGCGG - Exonic
1036920414 8:12848300-12848322 GGGGTCTACTTGAGGATGGAGGG + Intergenic
1037114363 8:15206015-15206037 GGGGTCTACTTGAGGATGGAGGG + Intronic
1037191430 8:16130635-16130657 GGGGTCTACTTGAGGGTGGAAGG - Intronic
1037253826 8:16928826-16928848 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1037320271 8:17634804-17634826 GGGGCCTACCTGGGGGTGGAGGG + Intronic
1037323776 8:17668829-17668851 GGGGCCTGCCTGAGGGTGGAGGG - Intronic
1037371791 8:18187691-18187713 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1037617745 8:20534677-20534699 GGGGTCTACTTGAGGGTGAAAGG - Intergenic
1038021607 8:23555835-23555857 CAGGTCACCCTGATGTTGGAGGG - Intronic
1038053412 8:23834791-23834813 GGGGCCTACCTGGGGGTGGAGGG - Intergenic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038261059 8:25994775-25994797 TGGGACTACTTGAGGGTGGAGGG + Intronic
1038270658 8:26072628-26072650 GGGTTCTACTTGAGGGTGGAGGG - Intergenic
1038285068 8:26199133-26199155 GAGGTCTACTCGAGGGTGGAGGG - Intergenic
1038328575 8:26590456-26590478 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328585 8:26590516-26590538 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328595 8:26590576-26590598 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328605 8:26590636-26590658 CAGTGACACCTGAGGGTGGATGG - Intronic
1038510145 8:28126184-28126206 GAGATCTCACTGAGGGTGGAGGG + Intronic
1038817562 8:30920792-30920814 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1038854335 8:31314688-31314710 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1038904193 8:31879711-31879733 CAGGTCTACTTGAGGGTGGAGGG - Intronic
1038920861 8:32082370-32082392 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1038949708 8:32401130-32401152 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1038988649 8:32841600-32841622 AAGGCCTACTTGAGGGTGGGAGG - Intergenic
1039028223 8:33281420-33281442 GGGATCTACCTGAGGATGGAGGG + Intergenic
1039106931 8:34000132-34000154 CAATTCTACCTGAGTGTGAAAGG + Intergenic
1039342215 8:36663342-36663364 GGGCTCTACTTGAGGGTGGAGGG - Intergenic
1039553307 8:38458880-38458902 CAGTTCTCCCTGATGCTGGAAGG + Intronic
1039793529 8:40893824-40893846 GGGGCCTACCTGAGGGTGGAGGG - Intronic
1040407613 8:47121796-47121818 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1040961515 8:53038569-53038591 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
1041013493 8:53567920-53567942 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1041179580 8:55233591-55233613 CAGGTCCACCTCAGTGTGGCAGG - Intronic
1041180628 8:55244220-55244242 GGGGTCTACTTGAGGCTGGAGGG - Intronic
1041306656 8:56468836-56468858 GGGGTCTACTTGAGGGGGGAAGG + Intergenic
1041399723 8:57429133-57429155 GGGGTCTACTTGAGGGTGAAGGG - Intergenic
1041404128 8:57478924-57478946 GAGGCCTACTTGAGGATGGAGGG - Intergenic
1041560238 8:59209255-59209277 GAGGACTACTGGAGGGTGGAAGG - Intergenic
1041577836 8:59420387-59420409 CGGGTCTACTTGAGGGTGAAGGG + Intergenic
1041655352 8:60344405-60344427 GAGGCCTCCTTGAGGGTGGAGGG + Intergenic
1041695243 8:60728971-60728993 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1041762196 8:61379085-61379107 CAGGTCTCTCTGAGGGTGCATGG - Intronic
1041791873 8:61705233-61705255 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1042046300 8:64655998-64656020 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1042401026 8:68347115-68347137 GGGGTCTACTTGAGAGTGGAGGG - Intronic
1043067201 8:75589945-75589967 TGGGCCTACTTGAGGGTGGAGGG - Intergenic
1043310135 8:78848698-78848720 GGGGTCTATTTGAGGGTGGAGGG - Intergenic
1043407818 8:79956634-79956656 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1043418594 8:80076492-80076514 GGGGCCTACCAGAGGGTGGAGGG + Intronic
1043433539 8:80216734-80216756 GGGGTCTACCTGAGGGTGGAGGG + Intronic
1043569437 8:81585996-81586018 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1043693394 8:83186490-83186512 GAGGTCTACTTGGGGGTGGAGGG + Intergenic
1043737960 8:83770531-83770553 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1043784076 8:84374696-84374718 ATGGCCTACTTGAGGGTGGAGGG + Intronic
1044109488 8:88254296-88254318 CAGGCCTATCAGAGAGTGGAGGG + Intronic
1044170576 8:89046745-89046767 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1044557926 8:93584839-93584861 GAGGTCTACTTGAGGGTGGAGGG + Intergenic
1044738076 8:95299514-95299536 GAGGTATCCCTGAGAGTGGAAGG + Intergenic
1044960848 8:97529289-97529311 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1045127462 8:99108000-99108022 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1045412948 8:101937343-101937365 GGGTTCTACTTGAGGGTGGAGGG - Intronic
1045555216 8:103208877-103208899 CAGGTCCTCCTGGGGGTTGAAGG - Intronic
1045619550 8:103958392-103958414 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1045813251 8:106249332-106249354 AGGGTCTACCTGAGGGGAGAGGG + Intergenic
1046449560 8:114370802-114370824 GGGGTCTACTTGAGGATGGAAGG + Intergenic
1046474586 8:114725256-114725278 CTGGCCTACTTGAGGGAGGAGGG + Intergenic
1046491818 8:114962896-114962918 CATGTCTACCTCATCGTGGAAGG - Intergenic
1046524299 8:115364440-115364462 GGGGCCTACCTGAGGGTGGAAGG - Intergenic
1046596474 8:116267036-116267058 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1046694254 8:117320870-117320892 GGGGTCTACCTGAGTGGGGAGGG + Intergenic
1046722065 8:117631621-117631643 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1046865359 8:119143438-119143460 ATGGCCTACTTGAGGGTGGAGGG + Intergenic
1047159101 8:122356547-122356569 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1047264888 8:123297233-123297255 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1047299810 8:123603863-123603885 GTGGTCTACTTGAGGGTGGAGGG + Intergenic
1047438530 8:124856352-124856374 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1047660380 8:127027362-127027384 GGGGTCTACTTGAGGATGGAGGG + Intergenic
1048001675 8:130384259-130384281 CAGGTCTCTCTCATGGTGGAGGG - Intronic
1048120536 8:131576051-131576073 GGGGTATTCCTGAGGGTGGAAGG + Intergenic
1048471873 8:134711530-134711552 GAGGTTTACCTGAGGGCGGGAGG + Intronic
1048723042 8:137348936-137348958 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1048763179 8:137819207-137819229 GAGGCCTACTAGAGGGTGGAGGG - Intergenic
1049102335 8:140588713-140588735 AAGGTGTACCTGTGGTTGGAAGG + Intronic
1049128622 8:140815402-140815424 GGGGCCTACCAGAGGGTGGAGGG + Intronic
1049248170 8:141573936-141573958 CAGGTCCAGCTGAGGCTGGCAGG - Intergenic
1049652673 8:143780477-143780499 AGGATCTACTTGAGGGTGGAGGG - Intergenic
1049823588 8:144652746-144652768 AGGGTCTACCTGAGGGTGGAGGG + Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050145441 9:2562350-2562372 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1050181713 9:2930136-2930158 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1050310085 9:4343904-4343926 GGGGCCTACCTGAGAGTGGAGGG + Intronic
1050498079 9:6265532-6265554 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1051054359 9:12966433-12966455 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
1051089816 9:13393207-13393229 GGAGTCTACTTGAGGGTGGAGGG + Intergenic
1051133835 9:13895077-13895099 GGGGGCTACCTGAGGGTGGAGGG + Intergenic
1051471821 9:17452277-17452299 CAGGTCTCCCTGATGGAGAAGGG + Intronic
1051551878 9:18338777-18338799 GAGGCCTACTTGAAGGTGGAGGG - Intergenic
1051861776 9:21633417-21633439 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1052071455 9:24086776-24086798 GGGGTCTACTTGAGGGTGGAGGG + Intergenic
1052074939 9:24129980-24130002 AAGGCCTACCTGGTGGTGGAGGG + Intergenic
1052393539 9:27909779-27909801 GGGGTCTACTTGAGGGTGGGAGG + Intergenic
1052638906 9:31138684-31138706 CGGTCCTACTTGAGGGTGGAGGG + Intergenic
1052669207 9:31534099-31534121 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1052735473 9:32338035-32338057 GAGGCCTACTTGAGGGTGGAGGG + Intergenic
1053035120 9:34820387-34820409 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1053100538 9:35368213-35368235 CGGGCCTACTTGAGGGTGAAGGG - Intronic
1053168101 9:35858910-35858932 CAGGTCCACCAGAGGCTGGTGGG - Intergenic
1053873382 9:42517905-42517927 GGGGCCTACCTGAGAGTGGAGGG + Intergenic
1054262285 9:62879561-62879583 GGGGCCTACCTGAGAGTGGAGGG + Intergenic
1054268947 9:62948847-62948869 GGGGCCTACCTGAGAGTGGAGGG - Intergenic
1054750481 9:68899920-68899942 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1055133160 9:72798672-72798694 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1055369885 9:75586213-75586235 AGGGCCTCCCTGAGGGTGGAGGG + Intergenic
1055531394 9:77187866-77187888 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1055624128 9:78155749-78155771 GGGGTGTACTTGAGGGTGGAGGG + Intergenic
1055990988 9:82105351-82105373 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1056485311 9:87051035-87051057 GGGGTCTACTTGAGGATGGAGGG - Intergenic
1057096219 9:92312487-92312509 GGGGTCTACTTGAGGGTGGAGGG + Intronic
1057360319 9:94367309-94367331 GGGGACTACTTGAGGGTGGAGGG - Intergenic
1057380679 9:94564649-94564671 GGGGCCTACGTGAGGGTGGAGGG + Intronic
1057395132 9:94673491-94673513 GAAGTCTACTTGAGGGTGGAGGG + Intergenic
1057492896 9:95536266-95536288 GCGGCCTACTTGAGGGTGGAGGG + Intergenic
1057638075 9:96789799-96789821 GAGGCCTACCTGAGGGTGAATGG - Intergenic
1057663023 9:97020768-97020790 GGGGACTACTTGAGGGTGGAGGG + Intergenic
1057695415 9:97319488-97319510 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1058199029 9:102015429-102015451 GGGGTCTACTTGAGGGTGGCGGG + Intergenic
1058460988 9:105182367-105182389 GGGCTCTACTTGAGGGTGGATGG - Intergenic
1058669953 9:107352425-107352447 GGGGTCTGCTTGAGGGTGGAGGG - Intergenic
1058831360 9:108820206-108820228 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1058833473 9:108839910-108839932 GGGGTCTACTTGAGGGTGGGAGG + Intergenic
1059017392 9:110534180-110534202 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1059036583 9:110760549-110760571 GGGATCTACCTGAGGGTAGAGGG + Intronic
1059218199 9:112586972-112586994 CAGCTCTACCTGTGGGGAGAAGG - Intronic
1059839763 9:118200768-118200790 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1059890342 9:118795100-118795122 GGGATCTACCTGAGAGTGGAGGG - Intergenic
1060337086 9:122735300-122735322 GTGGCCTACCTGAGGGTGGAGGG + Intergenic
1060502180 9:124167620-124167642 GCGGTCTACTTAAGGGTGGAGGG - Intergenic
1061616197 9:131780877-131780899 GAGGTCTACTTGAGGGTAGAGGG + Intergenic
1062299164 9:135854923-135854945 GGGGTCTCCTTGAGGGTGGAGGG - Intronic
1062756981 9:138304470-138304492 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1185693197 X:2173738-2173760 CACCTCTACTTGAGGGTGGAGGG - Intergenic
1185779263 X:2830332-2830354 CAGGTCTCTCTGGGGCTGGAGGG + Intronic
1185794851 X:2956204-2956226 AAGTACTACATGAGGGTGGAAGG + Intronic
1185829338 X:3284879-3284901 AACGCCTACTTGAGGGTGGAGGG - Intergenic
1185881973 X:3749409-3749431 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1185908623 X:3961417-3961439 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1185912309 X:3993597-3993619 GGGGTCTACTTGAGAGTGGAAGG + Intergenic
1185918879 X:4066916-4066938 GGGGACTACTTGAGGGTGGAGGG + Intergenic
1185930557 X:4198397-4198419 AGGGTCTACTTGAGGGTGAAGGG - Intergenic
1185932495 X:4218642-4218664 GGGGACTACTTGAGGGTGGAGGG + Intergenic
1186001563 X:5017752-5017774 GAGGCCTACTTGATGGTGGAGGG - Intergenic
1186018488 X:5226623-5226645 AGGACCTACCTGAGGGTGGAGGG + Intergenic
1186165570 X:6822857-6822879 GGGGTCTACCTGAGAGTGGAGGG - Intergenic
1186373292 X:8968628-8968650 AGGACCTACCTGAGGGTGGAGGG + Intergenic
1186378204 X:9031609-9031631 TGGGCCTACTTGAGGGTGGAGGG + Intronic
1186402338 X:9271353-9271375 AGGGCCTACATGAGGGTGGAGGG - Intergenic
1186415190 X:9377224-9377246 GGGGTCTACCTGAGGGTGGGGGG - Intergenic
1186605638 X:11087595-11087617 GAGGCCTACTTGAGGGTGGAGGG - Intergenic
1186632396 X:11364191-11364213 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1186653253 X:11584933-11584955 GAGGCCTTTCTGAGGGTGGAGGG - Intronic
1186696403 X:12037734-12037756 GGGGCCTACCTGAGGGTGGAGGG - Intergenic
1187035395 X:15533347-15533369 GAGGCTTACTTGAGGGTGGAGGG - Intronic
1187054292 X:15727343-15727365 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1187107348 X:16257542-16257564 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1187132450 X:16515956-16515978 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1187236620 X:17474079-17474101 GAGGCCTACTTGAGGGTGGAAGG - Intronic
1187297907 X:18020181-18020203 GGGGTCTATCGGAGGGTGGAGGG + Intergenic
1187306538 X:18100203-18100225 GGGGTCTACTTGAGGGTGGAAGG + Intergenic
1187529477 X:20083398-20083420 CAGGTATGCCTGAGTATGGATGG + Intronic
1187600286 X:20821733-20821755 AGGGTCTACTTGAGGGTGGAGGG + Intergenic
1187615348 X:20987767-20987789 TGGGCTTACCTGAGGGTGGAAGG + Intergenic
1187712055 X:22064301-22064323 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1187746426 X:22414215-22414237 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1187755865 X:22525535-22525557 GGGGTCTACTTGAGAGTGGAGGG + Intergenic
1187820293 X:23280236-23280258 GAGGCCTACTTGAGGGTGGAGGG + Intergenic
1187882123 X:23857075-23857097 GAGGCCTACTTGAGGGTGGAGGG + Intronic
1188134442 X:26477313-26477335 GGGGCCTACCTGAGGGTGAAGGG + Intergenic
1188148240 X:26640729-26640751 GGGGTCTACTTGAGGATGGATGG - Intergenic
1188154783 X:26727720-26727742 CATGTGTACCTGTGTGTGGATGG + Intergenic
1188172572 X:26945977-26945999 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1188184799 X:27100525-27100547 AGGGCCTATCTGAGGGTGGAGGG - Intergenic
1188319437 X:28717485-28717507 GAGGCCTACCAGAGGGTAGAGGG + Intronic
1188356893 X:29202847-29202869 AAGGCCTACTTGAAGGTGGAGGG + Intronic
1188362310 X:29271015-29271037 AAGGTCTACTTGAGGGTGGAGGG - Intronic
1188395247 X:29674721-29674743 GGGGCCTACCTGAGGGTGGAAGG - Intronic
1188414041 X:29910210-29910232 CAGGTATACTTGAGGGTGGAGGG + Intronic
1188810563 X:34649537-34649559 GGGGTCTACTTGAGGGTTGAGGG + Intronic
1188866500 X:35319628-35319650 GGGGCCTACCTGAGGGTGGAGGG - Intergenic
1188992581 X:36840693-36840715 GGGGTCTACTTGAGGGTGGATGG - Intergenic
1189036189 X:37495720-37495742 GGGGCCTACCTGAGTGTGGAGGG - Intronic
1189037697 X:37509262-37509284 GGGGCCTACCTGAGTGTGGAGGG - Intronic
1189095664 X:38136394-38136416 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1189570814 X:42294499-42294521 TGGGTCTACTTAAGGGTGGAAGG - Intergenic
1189571235 X:42300088-42300110 AAGGCCTACTGGAGGGTGGAGGG - Intergenic
1189611232 X:42738342-42738364 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1189720659 X:43912923-43912945 GGGGCCTACTTGAGGGTGGATGG - Intergenic
1190073032 X:47294380-47294402 GAGGCCTACTTAAGGGTGGAGGG - Intergenic
1190127523 X:47720018-47720040 GGGGTCTACTTGACGGTGGAGGG + Intergenic
1190133322 X:47771017-47771039 GGGGTCTACTTGAGGGTGTAGGG + Intergenic
1190333380 X:49248991-49249013 CAGCTCTGCCTGAGGGTGTGAGG - Intronic
1190447937 X:50549247-50549269 GGGGTCTACTTGAGGGTAGAGGG - Intergenic
1190513789 X:51202091-51202113 GGGGTCTACTTGAGGGTGGGAGG + Intergenic
1190589346 X:51983059-51983081 GAGGTGTACTTGAGAGTGGAGGG - Intergenic
1190812196 X:53895618-53895640 CGGGGCCACATGAGGGTGGAAGG + Intergenic
1190902739 X:54694480-54694502 GGGGCCTACCAGAGGGTGGAGGG + Intergenic
1190905861 X:54727271-54727293 GGGGTCTACTTGAGGGTGGGAGG + Intergenic
1190934403 X:54983326-54983348 GAGACCTACCTGAGGGTGGAGGG - Intronic
1191046237 X:56140591-56140613 AGGGCCTACTTGAGGGTGGATGG + Intergenic
1191147457 X:57183048-57183070 GAGGCCTACCTGAGGGCAGAAGG + Intergenic
1191661928 X:63660380-63660402 GGGGTTTACTTGAGGGTGGAAGG + Intronic
1191708204 X:64116371-64116393 CGGGCCTACCAGAGGTTGGAGGG - Intergenic
1191744593 X:64472604-64472626 CATGTGTACTTGAAGGTGGAAGG - Intergenic
1191777525 X:64832414-64832436 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1191818751 X:65278803-65278825 GGGGTCTACTTGAGGGGGGAGGG - Intergenic
1191878715 X:65822932-65822954 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1191927718 X:66331879-66331901 AGGGTGTACTTGAGGGTGGAGGG - Intergenic
1191983303 X:66950077-66950099 GAGACCTACCTGAAGGTGGATGG + Intergenic
1192019427 X:67369559-67369581 GGGGTCTACTTGAGGGTGGAAGG + Intergenic
1192354824 X:70391772-70391794 AGGGCCTACTTGAGGGTGGAGGG - Intronic
1192397753 X:70800230-70800252 GAGGTCTACTTGAGGGTGGAGGG + Intronic
1192839526 X:74839567-74839589 GGGGTCTACTTGAGGGTGAAGGG - Intronic
1192849325 X:74937718-74937740 AGGGTCTACTTAAGGGTGGAGGG - Intergenic
1192922938 X:75726674-75726696 TGGGCCTTCCTGAGGGTGGAGGG - Intergenic
1193187063 X:78525971-78525993 GGAGTCTACTTGAGGGTGGAGGG + Intergenic
1193264083 X:79447178-79447200 GGGGTCTACTTGATGGTGGAGGG - Intergenic
1193472961 X:81928808-81928830 AGGGTCTATTTGAGGGTGGAGGG + Intergenic
1193482074 X:82039016-82039038 AGGGCCTACCTGAGGGTGGAGGG + Intergenic
1193577833 X:83225286-83225308 GAGGTCTACTTGAATGTGGAGGG - Intergenic
1193609561 X:83612913-83612935 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1193629768 X:83869369-83869391 GGGGTCTATCAGAGGGTGGAGGG - Intronic
1193687748 X:84598937-84598959 GAGGCCTACATGAGGGAGGAGGG + Intergenic
1193748746 X:85316877-85316899 GGGGCCTACTTGAGGGTGGAGGG - Intronic
1193754450 X:85390134-85390156 GGGGTCTATCAGAGGGTGGAGGG + Intergenic
1193825377 X:86219463-86219485 GGGGTCTACTTGAGGGTGGAGGG - Intronic
1193827972 X:86250039-86250061 TGGGCCTACCTGATGGTGGAGGG + Intronic
1193836942 X:86355058-86355080 GAGGCCTACTTGAGGGTGGAGGG - Intronic
1193851739 X:86545390-86545412 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1193854711 X:86585563-86585585 AGGGCCTACCTGAGGATGGAAGG - Intronic
1194078536 X:89428752-89428774 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
1194091919 X:89587781-89587803 AGGGGCTACTTGAGGGTGGAGGG + Intergenic
1194101556 X:89711700-89711722 GGGGTCTATCAGAGGGTGGAGGG - Intergenic
1194112123 X:89847537-89847559 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1194133543 X:90110991-90111013 TAGGCCTACTTGAGGGTGGAGGG - Intergenic
1194167432 X:90536272-90536294 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1194179249 X:90692530-90692552 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1194234429 X:91364693-91364715 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1194243204 X:91477190-91477212 AAGGTCTACTTGAGGTTTGAGGG - Intergenic
1194290020 X:92060486-92060508 AGGGTCTACTTCAGGGTGGAGGG - Intronic
1194407192 X:93511273-93511295 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1194415840 X:93610619-93610641 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1194425602 X:93733655-93733677 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1194433191 X:93837160-93837182 GTGGCCTACTTGAGGGTGGAGGG - Intergenic
1194525494 X:94972126-94972148 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1194593454 X:95830020-95830042 GGGGTCTGCTTGAGGGTGGAGGG - Intergenic
1194619107 X:96146707-96146729 CGGGCCTACCTGAGGATGGAGGG + Intergenic
1194780857 X:98024039-98024061 GGGGTCTACTTGAGGGAGGAGGG - Intergenic
1194817935 X:98468001-98468023 AGGGACTACCAGAGGGTGGAGGG + Intergenic
1194912564 X:99664830-99664852 GGGGCCTACTTGAGGGTGGAGGG - Intergenic
1194948599 X:100097864-100097886 GGGGTCTACTTGGGGGTGGAAGG + Intergenic
1194984396 X:100474610-100474632 GGGGTCTACCTCAGGGTGGAAGG + Intergenic
1195280253 X:103326531-103326553 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1195288811 X:103411745-103411767 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
1195412185 X:104579593-104579615 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1195448553 X:104981977-104981999 GGGGCCTACTTGAGGGTGGAGGG + Intronic
1195472948 X:105253703-105253725 GGGGTCTACTTGAAGGTGGAAGG - Intronic
1195568821 X:106376766-106376788 GAGGCCTACCAGAGGGTGAATGG + Intergenic
1195586609 X:106572181-106572203 GGGGCCTACCTGAGGGTAGAGGG + Intergenic
1195909375 X:109874475-109874497 GGGGACTACTTGAGGGTGGAGGG - Intergenic
1195979721 X:110564352-110564374 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1196080695 X:111627621-111627643 TGGGTCTACTTGAGGGCGGAGGG + Intergenic
1196472330 X:116042571-116042593 GGGATCTACTTGAGGGTGGAGGG + Intergenic
1196494611 X:116309765-116309787 AAGGCCTACTTAAGGGTGGAGGG - Intergenic
1196584559 X:117414999-117415021 GGGGCCTACCTGAGGGTGGAGGG + Intergenic
1196613739 X:117743456-117743478 GAGATCTACCTGGGTGTGGAGGG - Intergenic
1197045491 X:121992272-121992294 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1197107798 X:122736422-122736444 AGGGCCTACTTGAGGGTGGAGGG + Intergenic
1197122792 X:122912115-122912137 GCAGTCTACTTGAGGGTGGAGGG + Intergenic
1197256772 X:124271935-124271957 GGAGTCTACTTGAGGGTGGAGGG + Intronic
1197259262 X:124299687-124299709 GGTGTCTACTTGAGGGTGGAGGG + Intronic
1197353597 X:125406345-125406367 GAGGTCTACTTGAGGGTAGAGGG - Intergenic
1197414523 X:126158515-126158537 GAGGTCTACTTGAAGGTGGAGGG - Intergenic
1197437318 X:126447393-126447415 GGGGTCTACCTGAGGGTTGAGGG - Intergenic
1197474713 X:126906751-126906773 GGAGCCTACCTGAGGGTGGAGGG + Intergenic
1197483063 X:127011049-127011071 GGGGCCTACCGGAGGGTGGAGGG + Intergenic
1197552484 X:127910215-127910237 GAGGTCTACTTCAGGGTGAAGGG + Intergenic
1197625577 X:128798561-128798583 AGGGCCCACCTGAGGGTGGAGGG + Intergenic
1197626779 X:128810832-128810854 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1197791070 X:130254747-130254769 AGGGCCTACTTGAGGGTGGAGGG + Intronic
1197813535 X:130472859-130472881 CGGGCCTGCATGAGGGTGGAGGG + Intergenic
1197913174 X:131507560-131507582 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1198076577 X:133199057-133199079 GGGGTCTACTTGAGGGTGGAGGG - Intergenic
1198107037 X:133471639-133471661 GGGGTCTACTTGAGAGTGGAGGG - Intergenic
1198225213 X:134638938-134638960 GGGGCCTAACTGAGGGTGGAGGG - Intronic
1198268104 X:135029836-135029858 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1198501187 X:137248815-137248837 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
1198579170 X:138044933-138044955 GGGATCTATCTGAGGGTGGAGGG + Intergenic
1198722298 X:139635877-139635899 CGGGTCTACTTGAGGGTGGAGGG - Intronic
1198794146 X:140377935-140377957 GGGGTCTACTTGTGGGTGGAGGG + Intergenic
1198796526 X:140402503-140402525 GGGGTCTATTTGAGGGTGGAGGG + Intergenic
1198819011 X:140625360-140625382 GGGGCCTACCTGAGGGTGGAGGG + Intergenic
1198945462 X:142008165-142008187 AGGGCCTACTTGAGGGTGGAGGG - Intergenic
1198974691 X:142323059-142323081 GGGGACTACCTGAGGGTGGAGGG - Intergenic
1199125266 X:144110939-144110961 CGGGCCTATCGGAGGGTGGAAGG + Intergenic
1199290136 X:146095890-146095912 CGGGCCTACTTGAGGGTGGAAGG + Intergenic
1199706609 X:150431569-150431591 GAGGCCTACTTGAGGGTGGACGG - Intronic
1199893541 X:152111716-152111738 GAGGTCTACTTGAGAGGGGAGGG - Intergenic
1200035388 X:153324726-153324748 GGGGTCTACTTGAGGATGGAGGG - Intergenic
1200304185 X:155008151-155008173 CAGGTCTCTGTGAGGATGGAGGG + Intronic
1200431144 Y:3083874-3083896 GGGGCCTACTTGAGGGTGGAAGG + Intergenic
1200444559 Y:3243843-3243865 AGGGACTACTTGAGGGTGGAGGG + Intergenic
1200454504 Y:3372786-3372808 GGGGTCTATCAGAGGGTGGAGGG - Intergenic
1200464778 Y:3502317-3502339 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1200479323 Y:3681094-3681116 TAGGCCTACTTGAGGGTGGAGGG - Intergenic
1200513695 Y:4114050-4114072 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1200525914 Y:4274695-4274717 GGGGCCTACTTGAGGGTGGAGGG + Intergenic
1201290784 Y:12420157-12420179 CAGGTCTCTCTGGGGCTGGAGGG - Intergenic
1201753387 Y:17459601-17459623 GAGACCTACTTGAGGGTGGAAGG + Intergenic
1201848166 Y:18446382-18446404 GAGACCTACTTGAGGGTGGAAGG - Intergenic
1201947330 Y:19526170-19526192 CAGGAATACCTGAGGAGGGAAGG + Intergenic
1202014632 Y:20387725-20387747 GTGGACTACGTGAGGGTGGAGGG + Intergenic
1202257488 Y:22937139-22937161 CAGGTCTTCCACAGTGTGGAAGG - Intergenic
1202300719 Y:23410952-23410974 GGGGTCTACTTCAGGGTGGAGGG + Intergenic
1202410478 Y:24570886-24570908 CAGGTCTTCCACAGTGTGGAAGG - Intergenic
1202460303 Y:25099186-25099208 CAGGTCTTCCACAGTGTGGAAGG + Intergenic
1202570092 Y:26259646-26259668 GGGGTCTACTTCAGGGTGGAGGG - Intergenic