ID: 933006974

View in Genome Browser
Species Human (GRCh38)
Location 2:77006801-77006823
Sequence GATTTCCACTGAAGCTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933006974_933006975 1 Left 933006974 2:77006801-77006823 CCAGCTAAGCTTCAGTGGAAATC 0: 1
1: 0
2: 0
3: 11
4: 77
Right 933006975 2:77006825-77006847 AAGTTGAACACCAAGAGTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 125
933006974_933006977 25 Left 933006974 2:77006801-77006823 CCAGCTAAGCTTCAGTGGAAATC 0: 1
1: 0
2: 0
3: 11
4: 77
Right 933006977 2:77006849-77006871 CAGAGCAGACCTTAATCCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933006974 Original CRISPR GATTTCCACTGAAGCTTAGC TGG (reversed) Intronic
906587370 1:46991313-46991335 GTTTTCCAGGGAGGCTTAGCAGG + Intergenic
910823196 1:91373869-91373891 GCTTACCACTCAATCTTAGCAGG - Intronic
911975686 1:104491165-104491187 GATTTCCACTGAAAGTCTGCTGG - Intergenic
912806766 1:112763037-112763059 GATTTCCTCTGATGCTTTTCTGG - Intergenic
921660120 1:217791300-217791322 AATTTCCACTGGAAATTAGCTGG - Intronic
1071399531 10:85256060-85256082 AAGTTCTACAGAAGCTTAGCTGG + Intergenic
1074176971 10:111017004-111017026 GGTTTCCACTGATGTTTAACAGG + Intergenic
1080766133 11:35298814-35298836 GATTTCCACTAAACCCTTGCAGG - Intronic
1086177086 11:83903834-83903856 CATTTCCACTGAAGATAAGAAGG - Intronic
1088670787 11:112138285-112138307 TATTTCAACTGAAGCTTTGCAGG + Intronic
1091432739 12:450702-450724 ATTTTCCACAGAAGCTTATCAGG - Intergenic
1092113477 12:5981544-5981566 AATTTCCACTCAGGCTGAGCTGG + Intronic
1093362352 12:18246243-18246265 GCTTCCCAATGAAGCATAGCTGG + Intronic
1093898140 12:24599314-24599336 GATTTTCTCTGAAGCTCAGCAGG + Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1098134359 12:67385972-67385994 AATATCCAGTGAAGCTTAGCTGG + Intergenic
1098171540 12:67751915-67751937 GATTTACATTGGAGCTTTGCTGG + Intergenic
1101599783 12:106199059-106199081 CATTTCCCCTGAATCTGAGCTGG + Intergenic
1102141083 12:110615312-110615334 GTTTTGCACTCAATCTTAGCGGG - Intronic
1102616452 12:114158710-114158732 GATTCCTACTGAAGACTAGCAGG + Intergenic
1105989005 13:25599662-25599684 GAATTCCAGGGAAACTTAGCTGG + Intronic
1106827477 13:33540106-33540128 CATTTCCCCTGAAGCTAAGGGGG - Intergenic
1110467836 13:75823275-75823297 AATTTCCACTGAATCTAAACTGG - Intronic
1113103554 13:106747907-106747929 GACTTCAACTCAAGCTTGGCTGG - Intergenic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1125976287 15:43954773-43954795 GATTTCATCTGAGGCTTTGCAGG - Intronic
1130586565 15:85188215-85188237 GAAAGCCCCTGAAGCTTAGCTGG + Intergenic
1136119699 16:28124452-28124474 CATTTGCACTGAGGTTTAGCAGG - Intronic
1150097638 17:62391886-62391908 GATGTGCACTGTAGCTAAGCTGG + Exonic
1150537109 17:66054563-66054585 GATGTCCATTGAAGCTTGTCTGG - Intronic
1151728516 17:75897773-75897795 CATTTCCCCTGAAGCTGAGCAGG + Intergenic
1153442838 18:5139944-5139966 TATTTCCACTGAAGCTGACCTGG - Intergenic
1161709852 19:5841753-5841775 AATTTCCTCTGAGGCTTAGAGGG - Intergenic
1161716056 19:5876905-5876927 AATTTCCTCTGAGGCTTAGAGGG - Intronic
1164818014 19:31221541-31221563 GATATCATCTGAAGGTTAGCTGG + Intergenic
928239009 2:29570383-29570405 GTTTTCCAAGGAAGCTTGGCAGG + Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
934900166 2:98153714-98153736 GAATTCAACTGAATTTTAGCTGG - Intronic
938422365 2:131155324-131155346 GCTTTCCACTGAAACGTGGCAGG - Intronic
942545342 2:177057547-177057569 CATTTTCACTGAAGGTTTGCAGG - Intergenic
943307493 2:186282260-186282282 CATTTACACTGAAGCTTACATGG - Intergenic
947316997 2:228870833-228870855 CAATTCCACTGAAGTTTAGTTGG - Intronic
1170538469 20:17364892-17364914 GGTTGCCACTGGAGCTCAGCTGG + Intronic
1173784661 20:45784000-45784022 CTTTTCCACTGGAGCTTGGCAGG - Intronic
954914356 3:54136046-54136068 GATTTCCAGTGGAGATCAGCTGG - Intronic
955666518 3:61355131-61355153 GCTTCCCACTCAAGCTTTGCTGG + Intergenic
960470394 3:118057591-118057613 GATTTCCACAAAACCTTAGGTGG - Intergenic
963431999 3:145219283-145219305 GATTGCTACTGAAATTTAGCAGG - Intergenic
965467432 3:169047868-169047890 GATTTTCAGTAAAGCATAGCTGG + Intergenic
966038294 3:175447702-175447724 GCTATCCACTGAATCTTGGCAGG - Intronic
966892924 3:184420494-184420516 AATTTCCACTGTAAGTTAGCTGG - Intronic
974589097 4:63920077-63920099 GTTTTTCACTGTAGCTCAGCTGG + Intergenic
975200704 4:71584714-71584736 GATTAAGGCTGAAGCTTAGCAGG - Intergenic
977249406 4:94673045-94673067 TAAGTCCACTGAAGCATAGCTGG + Intergenic
979555773 4:122045659-122045681 GGTTTCCACTAAAGCTTAACAGG + Intergenic
981732604 4:147915280-147915302 AATCTGCACTGAAGCTGAGCTGG + Intronic
984469845 4:180154596-180154618 TCTTTCCTCTGAAGCTTACCAGG + Intergenic
998393496 5:141803205-141803227 AATTTCCCCTGAATCTTACCAGG + Intergenic
998566459 5:143220268-143220290 GATTTTTCCTGAAGCTTAGGTGG + Intronic
1000529012 5:162394946-162394968 GATTTCAACAGAAACCTAGCAGG + Intergenic
1002630844 5:180576225-180576247 AATTTCCAGTGAAGGTGAGCTGG + Exonic
1003635414 6:7827241-7827263 GTTTTCCCCTGAAGCGCAGCAGG - Intronic
1003656938 6:8020533-8020555 GATTTCCAGAGAAACTCAGCTGG - Intronic
1011381708 6:86749184-86749206 GATTTCTAATGGAGCTTAGGAGG + Intergenic
1023183462 7:37509854-37509876 GGTTTCCACTGAGACTTAGCAGG + Intergenic
1023491362 7:40746063-40746085 CATTTCCAATGAAGTTTAGAGGG + Intronic
1025952152 7:66153723-66153745 GATTTCAGCTGAAGCTCAGATGG - Exonic
1028477832 7:91270302-91270324 GTTTTCCACTTAAGCTTTGTGGG + Exonic
1033258976 7:139825906-139825928 GATTTCCAATGCATATTAGCAGG + Intronic
1035993156 8:4514963-4514985 CATTTCCACTGAGGCTTAAAAGG - Intronic
1037643577 8:20770693-20770715 GATTTCCATTGAAACCGAGCTGG + Intergenic
1040601015 8:48883849-48883871 GTTTTCCACTGGAGCTTGGCTGG + Intergenic
1044081397 8:87889705-87889727 GATTTCCACTGTTGCTTAATTGG - Intergenic
1044369783 8:91395849-91395871 GTTTTCCACTGAAGCTTTGTTGG + Intronic
1046313786 8:112474003-112474025 GATTTCCTTTGAAGTTTTGCAGG + Intronic
1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG + Intergenic
1048261219 8:132946775-132946797 GAGTGCAACTGAAGCTAAGCTGG + Intronic
1049840366 8:144767128-144767150 GAATTCCACTCATGCTTGGCAGG + Intergenic
1050765664 9:9130357-9130379 GAATTCCAATGAAACTTAACTGG - Intronic
1051182462 9:14425632-14425654 GCTATCCACTGAAGCTTAGATGG + Intergenic
1052336977 9:27330247-27330269 GAATTCCAGTAAAGCTTAGGCGG + Exonic
1055995648 9:82156688-82156710 CATTTCCACAGAAGATTTGCAGG - Intergenic
1056758883 9:89400750-89400772 GATTTTCACTGATGCTTGGCGGG + Intronic
1057481442 9:95448204-95448226 GATTCACACTGCAGCTCAGCGGG + Intronic
1058939494 9:109799853-109799875 GCTTTCCACTGAAGCTGGGGAGG - Intronic
1060090078 9:120735038-120735060 GATTCTCACTGAAGCCCAGCAGG - Intergenic
1191030627 X:55966102-55966124 GTTTTCTACTGCAGCTAAGCTGG - Intergenic
1196302865 X:114066502-114066524 TAGTTCCTCTGAAGCTTTGCAGG - Intergenic
1197871079 X:131063445-131063467 GATTTCCACAGAAGCATACAGGG + Intronic