ID: 933006977

View in Genome Browser
Species Human (GRCh38)
Location 2:77006849-77006871
Sequence CAGAGCAGACCTTAATCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933006976_933006977 -9 Left 933006976 2:77006835-77006857 CCAAGAGTAGAGGTCAGAGCAGA 0: 1
1: 0
2: 2
3: 21
4: 252
Right 933006977 2:77006849-77006871 CAGAGCAGACCTTAATCCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 145
933006974_933006977 25 Left 933006974 2:77006801-77006823 CCAGCTAAGCTTCAGTGGAAATC 0: 1
1: 0
2: 0
3: 11
4: 77
Right 933006977 2:77006849-77006871 CAGAGCAGACCTTAATCCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933006977 Original CRISPR CAGAGCAGACCTTAATCCTG TGG Intronic
902623765 1:17665047-17665069 CAGACCAGTCCCTCATCCTGGGG - Intronic
903249418 1:22041776-22041798 CAGATCAGACCTTGCTCCTTTGG + Intergenic
904883075 1:33715119-33715141 CAGAGAAGAGCTGAGTCCTGAGG - Intronic
905100696 1:35519537-35519559 CAGAGCAGACCTTGATTATATGG + Intronic
907595989 1:55720406-55720428 CAGAGCAGGGCTTTATCCTCAGG + Intergenic
910538987 1:88333215-88333237 CAGAGCAGACCGTATTTCTGAGG - Intergenic
912062179 1:105687023-105687045 CAGGGATGACCTGAATCCTGGGG - Intergenic
912229801 1:107779424-107779446 CAGAGCTTACCTGATTCCTGTGG + Exonic
913053703 1:115138760-115138782 GAGAGCAGACCCTCATGCTGAGG - Intergenic
913508334 1:119539850-119539872 CAGACCAGAGCTTCATCCAGAGG + Intergenic
915593019 1:156881283-156881305 CAGAGCAGAAATGAATCCTGGGG + Intronic
921035933 1:211378216-211378238 CAGAGAAGGCCTTAATGCTGAGG + Intergenic
922536422 1:226384358-226384380 CAGAGCTGGCCTTGATTCTGTGG + Intronic
1063435235 10:6024150-6024172 CAGGGCAGACCTTCTTCCTTTGG + Intronic
1064232688 10:13543365-13543387 CTGAGGCTACCTTAATCCTGGGG - Intergenic
1065976551 10:30847165-30847187 CAGAGAAGCCCTGAAGCCTGGGG + Intronic
1066449377 10:35514376-35514398 CAGATCAGCCCTTAGTTCTGGGG + Intronic
1068012894 10:51476772-51476794 CAGAGAAGAACTTAATCCAGGGG - Intronic
1069898965 10:71696128-71696150 CAGCGGAGACCAGAATCCTGGGG + Intronic
1073572983 10:104596579-104596601 GAGATAAGACCTTAATCCAGGGG - Intergenic
1075468856 10:122672837-122672859 CAGAGCTGAGCTCACTCCTGAGG + Intergenic
1081018704 11:37915602-37915624 CAGAGTAGAACTTAATCCCTAGG - Intergenic
1081918779 11:46753309-46753331 CAGACCAGACCAACATCCTGAGG - Exonic
1088412141 11:109545951-109545973 TTGAGCAGACCTTAATCCCAAGG - Intergenic
1089002100 11:115060399-115060421 CAGCCCAGATCTCAATCCTGAGG - Intergenic
1091996714 12:4999655-4999677 GAGACCAGAGCTTAGTCCTGTGG - Intergenic
1092580115 12:9831635-9831657 CCCAGCAGACCTAAATCCTCTGG + Intronic
1095231107 12:39741317-39741339 TAGAGCCTACCTTAATCCTGGGG + Intronic
1095773971 12:45991848-45991870 GGGAGCAGAGCTTAGTCCTGCGG - Intronic
1097715195 12:62959016-62959038 CAGTGCAGACTTCCATCCTGAGG - Intergenic
1097751071 12:63353419-63353441 CAGAGAATTCCTTAAACCTGGGG + Intergenic
1102970820 12:117164780-117164802 TAGAGCAGAATTTAATTCTGAGG - Intronic
1106308902 13:28535530-28535552 CAGGGCAGTCCTGAAGCCTGGGG + Intergenic
1107142729 13:37019959-37019981 CAGAGCATATCTTAAAGCTGGGG + Intronic
1115316224 14:32027758-32027780 CAGAGAAGAGCTGAGTCCTGTGG + Intergenic
1117846431 14:59916288-59916310 CAGTGCAGACCTGATACCTGAGG - Intergenic
1118302857 14:64630734-64630756 CACAGCAGAGCTGAGTCCTGGGG - Intergenic
1120236963 14:81903489-81903511 AACAGCAGGCCTGAATCCTGGGG + Intergenic
1122013526 14:98773544-98773566 CAAGGCAGACCTTTAGCCTGGGG - Intergenic
1122073082 14:99217819-99217841 CAGAGCACACCTGAAGCCTGTGG - Intronic
1127344499 15:58080647-58080669 CAGAGGGAACCTTAGTCCTGGGG + Intronic
1129937050 15:79459552-79459574 CAGAGAAGGCCCTACTCCTGAGG + Intronic
1132638667 16:966905-966927 CAGATAACACCTTAATTCTGAGG + Intronic
1133820667 16:9233494-9233516 CAGTGAAAACCTTGATCCTGAGG - Intergenic
1134623063 16:15704429-15704451 CACAGCAGACCAGAATCCTGTGG - Intronic
1137683642 16:50371442-50371464 CAGAGCTGACTTGAGTCCTGGGG + Intergenic
1144620156 17:16813548-16813570 GAGAGCAAACTTTAATCCCGAGG + Intergenic
1145209915 17:21005182-21005204 CAGAGCACACCTGGGTCCTGAGG + Intronic
1146995957 17:37321288-37321310 CTGTGCAGACCTTTATCCTTGGG - Intronic
1147161945 17:38573494-38573516 TTGAGCAGACCTTCCTCCTGGGG - Intronic
1147723031 17:42550304-42550326 CAGAGAAGACCCTCATCCAGAGG - Exonic
1148384110 17:47222084-47222106 CAGAGCAGGGCTTACTACTGAGG + Intronic
1149052109 17:52318082-52318104 CAGAGGAGACCTAAATCTTCAGG - Intergenic
1151395308 17:73819372-73819394 CAGAGCAGGCCTGAAGCCTGGGG - Intergenic
1151699385 17:75734890-75734912 CAGAGCAGGACTTCATCCTTTGG + Intronic
1155557973 18:27042747-27042769 GAGAGAAGAGCTTAATCCTTAGG - Intronic
1157408183 18:47441186-47441208 CAGAGGAGAGCTGAATGCTGAGG - Intergenic
1157718038 18:49902668-49902690 CTGAGCGGGCCTCAATCCTGAGG + Exonic
1162075580 19:8184788-8184810 TAGAGCACACCTTGTTCCTGGGG + Intronic
1163260362 19:16185866-16185888 CAGAGGAGACCTTAATTACGGGG + Intronic
1163668377 19:18613513-18613535 CAGATCAGGCTTGAATCCTGGGG - Intronic
928126122 2:28617901-28617923 CAGTGCAGACCTAGATCCTGCGG + Intronic
928321677 2:30288579-30288601 CAGAGGAGAGTTTAATCCTGAGG - Intronic
929266585 2:39925548-39925570 CAGAGCAGACCTCAACCTGGTGG + Intergenic
929270008 2:39962093-39962115 CTGAGCAGACATTAATTCCGTGG - Intergenic
932394793 2:71435430-71435452 CAGAGCAGCCATTACTTCTGTGG + Intergenic
932769922 2:74495143-74495165 CGGAGCAGACCTCCATCCAGAGG + Intergenic
933006977 2:77006849-77006871 CAGAGCAGACCTTAATCCTGTGG + Intronic
937211944 2:120279716-120279738 CCGAGCAGAGCTTAAACCTCAGG + Intronic
938733111 2:134161553-134161575 CAGAGCAGAAGACAATCCTGAGG - Intronic
941953072 2:171176563-171176585 CAGATCAGAACTTAATTATGTGG - Intronic
942106859 2:172641937-172641959 CAGAGAAAACCTTTGTCCTGAGG + Intergenic
944539479 2:200742371-200742393 AAGTGCAGACCTTAAGCCAGAGG + Intergenic
945035743 2:205702698-205702720 CAGACCAGACCTTAGTCATCTGG + Intronic
946317746 2:218929032-218929054 CAGAGCAGACCATCAGCCTGGGG - Intergenic
947045356 2:225976903-225976925 CAGTGCAGAAATTTATCCTGTGG + Intergenic
947248891 2:228079419-228079441 TGGAGCAGACCTGAAGCCTGGGG - Intronic
947324528 2:228959960-228959982 CAGAGCAGACCGTGCTTCTGAGG + Intronic
947627792 2:231631629-231631651 CAGAGGTGACCATTATCCTGAGG - Intergenic
1170786759 20:19473852-19473874 CAGATCAGTCCTTAATTCTGTGG + Intronic
1173228673 20:41177315-41177337 CAGGGCAGTCTTTAGTCCTGTGG - Intronic
1175686949 20:61038255-61038277 CAGAGTAGGCCTTAATTATGAGG + Intergenic
1176674888 21:9768498-9768520 CAGAGGAGGCCTCAACCCTGCGG - Intergenic
1178735840 21:35149657-35149679 AAGAGCAGACATTAACACTGAGG - Intronic
1179293531 21:40040808-40040830 GAGAGAAGACCATAAGCCTGTGG - Intronic
1182057315 22:27369751-27369773 CAGAGCAGACACAAATCCTGAGG - Intergenic
951333588 3:21394564-21394586 TAGAGCAGAACTTCATCCTTTGG + Intergenic
953224368 3:41002740-41002762 CAGAGCATACCCTAATACTAGGG - Intergenic
954335300 3:49912916-49912938 CAGAGCAGGCCTAACTCGTGAGG + Intronic
955397832 3:58569589-58569611 CAGAGCTGGCTTTCATCCTGGGG - Intronic
955737900 3:62059028-62059050 CAGAGCAGACCGGATACCTGGGG - Intronic
958174735 3:89982648-89982670 CAGATCCGCCCTTAATCTTGTGG + Intergenic
960169266 3:114439232-114439254 AAGAGCAGACTTTCATCCAGGGG - Intronic
961565941 3:127763442-127763464 CAGAGCTGGCCTTGAGCCTGAGG - Intronic
965215149 3:165854084-165854106 AAGAGAAGACCTTATACCTGAGG - Intergenic
969043089 4:4316372-4316394 CAGAGCAGACTTTATTCTCGTGG + Intronic
970026725 4:11632024-11632046 AAGATCAAACCTGAATCCTGGGG - Intergenic
971714112 4:30153519-30153541 CAGGGCAGGCCTGAAGCCTGGGG - Intergenic
973015469 4:45132486-45132508 CAGAGCAGTCCTCAATCTAGGGG + Intergenic
977033916 4:91924970-91924992 CAGGGCAGGCCTGAAACCTGGGG + Intergenic
977676198 4:99750269-99750291 CACAGAAGAACTTTATCCTGTGG + Intergenic
978061455 4:104344937-104344959 CAGGGAAGACCTGAAGCCTGGGG + Intergenic
978559851 4:110021728-110021750 CAGAGGAGGCCTAAATCCTGGGG + Intergenic
981041735 4:140229498-140229520 CAGAGCAGACCTGAAATCAGAGG - Intergenic
986505692 5:8448457-8448479 CAGAGCAGGCCTTCACCTTGAGG - Intergenic
989803316 5:45572232-45572254 TAAATCAGACCTTAACCCTGAGG + Intronic
995962062 5:117853647-117853669 CAGGGTAGACGTTAAGCCTGCGG - Intergenic
997858108 5:137391462-137391484 GAGAACAGACTTCAATCCTGAGG + Intronic
997928636 5:138053954-138053976 GAAAGAAGACCTTTATCCTGTGG + Intergenic
998429755 5:142060767-142060789 GGGAGCAGCCCTTTATCCTGGGG + Intergenic
998529706 5:142873038-142873060 CAGAGCAGACCTGCAGGCTGTGG + Intronic
999508052 5:152218843-152218865 CAAAGCAGAGCTCAGTCCTGAGG + Intergenic
1001315082 5:170636300-170636322 CAGAGCAGAGCTGAGCCCTGAGG + Intronic
1002512557 5:179732618-179732640 CTGGGCGGGCCTTAATCCTGGGG - Intergenic
1004280200 6:14274128-14274150 CAGAGCAGACTTTATTCAAGGGG + Intergenic
1010508321 6:76687411-76687433 CAGAGCTGACACTAATCCTTAGG + Intergenic
1012693342 6:102346332-102346354 CACAGGAGACATTAAACCTGAGG + Intergenic
1012975590 6:105778028-105778050 GAGACCAGACCTTAATATTGGGG - Intergenic
1016362209 6:143279557-143279579 CAGAGCAGTCCTCACACCTGAGG - Intronic
1016903812 6:149129402-149129424 CAGATCAACCCTTAATCTTGTGG - Intergenic
1019339806 7:503607-503629 CAGAGCTGACCTTCTCCCTGGGG - Intronic
1019502528 7:1371527-1371549 CAGACCAGAACTGAATCCAGAGG - Intergenic
1019616981 7:1968186-1968208 CAGAGCACGCCTCAATCCGGCGG + Intronic
1019653302 7:2172482-2172504 CAGAGGAGCCCTTTGTCCTGAGG - Intronic
1027140443 7:75653199-75653221 CAGAGCAGACCCCCAGCCTGGGG - Intronic
1030146161 7:106358244-106358266 AAAAGCACAGCTTAATCCTGTGG - Intergenic
1030807725 7:113937356-113937378 CATAGCAGACTTCAGTCCTGGGG - Intronic
1031614412 7:123864333-123864355 CAGAACAGACCTTACTTCTAAGG + Intronic
1032566879 7:132955660-132955682 CAGAGCAGACTTTATTCAAGAGG + Intronic
1033468015 7:141614700-141614722 CAGAGGAGACCATTATCCTGAGG - Intronic
1033627554 7:143125385-143125407 CAAAGCAGACCTTCTTGCTGGGG + Intergenic
1033855633 7:145558055-145558077 CAGAGCAGGCCTGAATGCTGAGG + Intergenic
1037314401 8:17587444-17587466 CAAATTAGACCTTAATCCAGAGG + Intronic
1039981237 8:42411287-42411309 CAGAGGAGCCCTTAAGCCTAGGG + Intergenic
1041359825 8:57041348-57041370 AAAAGCAGAGCTTAGTCCTGAGG + Intergenic
1041393553 8:57368947-57368969 CAGAGCAGTCCTGTTTCCTGTGG - Intergenic
1041578837 8:59433371-59433393 CAAAATAGACCTTAATCCTGAGG - Intergenic
1045061732 8:98417091-98417113 CAGAGCAGAGCTGAGTGCTGGGG + Intronic
1045303928 8:100940193-100940215 CAGCGCAGGCCTAGATCCTGGGG - Intronic
1046808402 8:118505409-118505431 CAGACCAGAACTTAATCATATGG - Intronic
1051059301 9:13027636-13027658 CAGAACAGACCCAAATTCTGTGG + Intergenic
1051579277 9:18653251-18653273 CAGAGCTGAACTTAATATTGTGG - Intronic
1052024055 9:23555720-23555742 CACAGCAGCCCTTAATTTTGGGG - Intergenic
1052519784 9:29531703-29531725 CAGAACAGACCTTATTCCAAAGG - Intergenic
1052998972 9:34566743-34566765 CAGTGTGGCCCTTAATCCTGGGG + Intronic
1057825947 9:98372106-98372128 CAGGGCACACCTTGGTCCTGGGG - Intronic
1058454824 9:105129254-105129276 CAGAGAAGAGCCTAATCCTGGGG + Intergenic
1060758303 9:126228204-126228226 GAGAGGAGAGCTTCATCCTGCGG + Intergenic
1061654375 9:132077650-132077672 AAGAGCAGTCTTTGATCCTGGGG - Intronic
1061988500 9:134144344-134144366 CAGAGCTGACCTTCAGACTGGGG + Intronic
1062247484 9:135576653-135576675 CAGGGCAAACCTTAATGTTGGGG - Intergenic
1185840596 X:3386613-3386635 CAGAGCTGACCTTGCTACTGGGG - Intergenic
1189245556 X:39560785-39560807 CACAGCAGACCTTGGTCCTTTGG - Intergenic
1194316136 X:92379616-92379638 CAGAGAAGGCCTGAAGCCTGGGG + Intronic
1194896748 X:99451714-99451736 CAGAGCAGACTTTATTTATGAGG - Intergenic
1195533380 X:105982717-105982739 CACAGGAGACTTTAATCCTAGGG - Intergenic
1195681187 X:107547788-107547810 CAGAGCAAAAATAAATCCTGTGG + Intronic
1195946901 X:110224154-110224176 CACAGCACAGCTTAGTCCTGTGG - Intronic
1198527303 X:137514383-137514405 CAGCCCAGACCTTTCTCCTGAGG - Intergenic
1200068514 X:153516707-153516729 CAGACCAGAGCTGAATACTGGGG - Intergenic
1200624181 Y:5491190-5491212 CAGAGAAGGCCTGAAGCCTGGGG + Intronic
1201728218 Y:17177994-17178016 AAGGGCAGACTTTAACCCTGAGG - Intergenic
1202341457 Y:23873453-23873475 CAGAACAGCCCTTAATCTGGTGG - Intergenic
1202529309 Y:25796633-25796655 CAGAACAGCCCTTAATCTGGTGG + Intergenic