ID: 933010305

View in Genome Browser
Species Human (GRCh38)
Location 2:77053660-77053682
Sequence TATTACCTCTAGCAGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933010305_933010306 10 Left 933010305 2:77053660-77053682 CCTTTTATCTGCTAGAGGTAATA 0: 1
1: 0
2: 2
3: 9
4: 160
Right 933010306 2:77053693-77053715 GTCTCTTTGCCAAACATAAAAGG 0: 1
1: 0
2: 2
3: 12
4: 204
933010305_933010309 19 Left 933010305 2:77053660-77053682 CCTTTTATCTGCTAGAGGTAATA 0: 1
1: 0
2: 2
3: 9
4: 160
Right 933010309 2:77053702-77053724 CCAAACATAAAAGGAACATTGGG 0: 1
1: 0
2: 2
3: 39
4: 356
933010305_933010307 18 Left 933010305 2:77053660-77053682 CCTTTTATCTGCTAGAGGTAATA 0: 1
1: 0
2: 2
3: 9
4: 160
Right 933010307 2:77053701-77053723 GCCAAACATAAAAGGAACATTGG 0: 1
1: 0
2: 2
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933010305 Original CRISPR TATTACCTCTAGCAGATAAA AGG (reversed) Intronic
900729858 1:4249702-4249724 AACTACCTCAATCAGATAAAGGG - Intergenic
901858511 1:12059442-12059464 AAATACCCTTAGCAGATAAAGGG - Intergenic
906441635 1:45851725-45851747 TATTAGGTCAAGCAGAAAAAAGG - Intronic
908018055 1:59867223-59867245 TATTATCTCTAAGTGATAAATGG - Intronic
908326450 1:63028430-63028452 GGTTTCCTCTAGCAGAAAAAGGG - Intergenic
909073349 1:71023502-71023524 TATGGCCTATAGCACATAAATGG - Intronic
909246141 1:73287344-73287366 TATTTCTTCTACCACATAAAAGG + Intergenic
910033753 1:82765143-82765165 TATTTACTCTGGCAGACAAATGG + Intergenic
910944885 1:92579632-92579654 TATTACTTTTAGCTTATAAATGG + Intronic
917746110 1:178009365-178009387 TATTCCCTCTAGCAGCAAATGGG - Intergenic
921505473 1:215963599-215963621 TATTACCAGCAGGAGATAAATGG + Intronic
921805043 1:219444604-219444626 TATTCCCTTTAGGAGATAAAAGG - Intergenic
1064677861 10:17779948-17779970 TATTCCCACTAGCAGAAGAAAGG - Intronic
1065237111 10:23664173-23664195 TATTAACTCTCCCAGATACATGG + Intergenic
1065507373 10:26442800-26442822 GATTACCTCTAGCTGGGAAATGG - Intronic
1068443105 10:57085115-57085137 CATTACCTCTAGCAGAAACTAGG + Intergenic
1070228613 10:74539581-74539603 TATCACTTATAGCAGAAAAAGGG - Intronic
1072907520 10:99468062-99468084 TTTTACCTCTAGAAGAAAATGGG - Intergenic
1074355789 10:112781930-112781952 TAATACCTGTAGCAGATAAATGG - Intronic
1074492642 10:113952980-113953002 TTTTACCTCTAGCATTTAGATGG - Intergenic
1077348312 11:2075213-2075235 TATTAGCTCTAGCATATATATGG + Intergenic
1077582328 11:3424260-3424282 TATTACCTCTTTCAGATGAGAGG + Intergenic
1081784183 11:45734783-45734805 TATTACCTCTTGCAGTTCCATGG - Intergenic
1082910683 11:58370870-58370892 TATTTTCTTTAGGAGATAAAAGG - Intergenic
1084239239 11:67807081-67807103 TATTACCTCTTTCAGATGAGAGG + Intergenic
1084833194 11:71785765-71785787 TATTACCTCTTTCAGATGAGAGG - Intergenic
1086486103 11:87303696-87303718 TAATACATCTAGAAGATAACAGG + Intronic
1090295847 11:125587409-125587431 TATAACCTACAGCAGTTAAAAGG + Intergenic
1091944694 12:4527149-4527171 TGTTCCCTCTAGTGGATAAAAGG + Intronic
1092942602 12:13424333-13424355 TATTATCTCTAGAAGATACTGGG - Intergenic
1094592379 12:31833822-31833844 TTTTACCTTTAGCGGATAGAAGG + Intergenic
1097479609 12:60105736-60105758 TATTGCCTTTAACAGATGAAGGG + Intergenic
1097814706 12:64059958-64059980 TATTTCCCCAAGCAGAAAAAAGG - Intronic
1098822252 12:75247526-75247548 TATAGCATCTAGTAGATAAAGGG + Intergenic
1100047694 12:90403502-90403524 TTTAACCTCTATCAGATATATGG - Intergenic
1104630304 12:130395118-130395140 CATTTCCTCTTGCAGTTAAATGG - Intergenic
1107589613 13:41888758-41888780 TATTACCTCTAGTGTATAACAGG + Intronic
1107789390 13:43986359-43986381 TATTACTACAAGCAGATAACGGG - Intergenic
1108069907 13:46617608-46617630 AATTCCCTCTAGCAAAGAAAAGG - Intronic
1108832232 13:54494523-54494545 TATTACCTATAGAAGATAGATGG + Intergenic
1111370291 13:87308103-87308125 TATTAACAATAGCAAATAAATGG + Intergenic
1112351459 13:98638258-98638280 TATTACCTCAAGGATACAAAAGG + Intergenic
1112559168 13:100496649-100496671 TATTTCCTTTACCAGATAAATGG - Intronic
1117951485 14:61086917-61086939 AATTTCCTCAAGCTGATAAAGGG + Intergenic
1118825183 14:69373446-69373468 AATTACCTCTGGCACAGAAAAGG + Intergenic
1124448437 15:29761762-29761784 TATTTTCTGTTGCAGATAAATGG - Exonic
1126043050 15:44611316-44611338 TACTGACTCTAACAGATAAATGG + Intronic
1126606645 15:50484526-50484548 TATTTCCTTTAGCATATAAATGG - Intronic
1127415690 15:58755137-58755159 TATTTTATCTTGCAGATAAAAGG - Intergenic
1133198730 16:4189303-4189325 AGTTAACTCTACCAGATAAAAGG + Intergenic
1133350908 16:5099488-5099510 TATTACCTCTTTCAGATGAGAGG + Intergenic
1137245373 16:46699018-46699040 CATTACCTGTAGCAGATAAAAGG - Intergenic
1147304584 17:39554448-39554470 TATCCCCTCTATCAGAAAAATGG - Intronic
1147354173 17:39879624-39879646 TATAACTTCTAGAAGATAACAGG - Intergenic
1150349341 17:64430664-64430686 CATTGCCTGTAGCAGAGAAAGGG + Intergenic
1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG + Exonic
1157111941 18:44829041-44829063 GGTTACATCTACCAGATAAATGG + Intronic
1158013875 18:52761405-52761427 TCTTACCTCTACCAAATAATAGG - Intronic
1159704461 18:71669136-71669158 AATTAGCTCTAGCAGACATAAGG + Intergenic
1160012232 18:75114923-75114945 TATTACCTCTAGTGGATGTATGG - Intergenic
926029607 2:9574723-9574745 TTTTACCTTTTACAGATAAAAGG - Intergenic
926772833 2:16393389-16393411 TATTAGCTCTTGGAAATAAAGGG + Intergenic
928916529 2:36477683-36477705 TATTACTTCTTGGAGAGAAAAGG - Intronic
931069754 2:58632069-58632091 TCTAACCTCTTCCAGATAAATGG + Intergenic
932299391 2:70655379-70655401 TAATATCTCTGGCAGATAGAGGG + Intronic
933010305 2:77053660-77053682 TATTACCTCTAGCAGATAAAAGG - Intronic
935389581 2:102536330-102536352 TATGACCTCTACCAACTAAAAGG - Intergenic
939183183 2:138827422-138827444 TATTACAAATAGCAAATAAAAGG - Intergenic
939391796 2:141577685-141577707 TATTACCTCTCGCAGATCATAGG + Intronic
939449843 2:142359869-142359891 TATTACCTCTGGAAAGTAAATGG - Intergenic
939685486 2:145193878-145193900 TATTACATCTGTCAGATTAAAGG - Intergenic
939749457 2:146024232-146024254 TATCACCTCTAGATGATACATGG + Intergenic
940030709 2:149258671-149258693 TATTTCCTCTAGTGGAGAAAAGG + Intergenic
940489983 2:154347035-154347057 TATTACCTCATGCAGAAAATTGG + Intronic
941425426 2:165338776-165338798 TATTACCTCTAAAAGAATAAAGG + Intronic
942005748 2:171698124-171698146 TATTAACACCATCAGATAAAAGG - Intronic
942710248 2:178826593-178826615 CAATATCTCTAACAGATAAAGGG + Intronic
943132648 2:183873781-183873803 TATTAAATCTAGCAAACAAATGG - Intergenic
945814290 2:214585162-214585184 TACTACTTCTATAAGATAAAGGG + Intergenic
945888816 2:215406694-215406716 TATTACCTATTTTAGATAAAAGG - Intronic
1170291873 20:14779335-14779357 AATTACCTTTTGCAGGTAAAAGG - Intronic
1170924032 20:20706309-20706331 TATAACCTCTAGAATGTAAATGG - Intronic
1170924131 20:20707372-20707394 TATTACTTCTATCAGGAAAAGGG + Intronic
1176971692 21:15273401-15273423 TATTTACTTTAGCAAATAAAAGG + Intergenic
1180570786 22:16717075-16717097 TATTAGCTCCATCAGATACACGG - Intergenic
1182327056 22:29521239-29521261 AATGACCTCAAGCATATAAACGG - Intronic
957055161 3:75436832-75436854 TATTACCTCTTTCAGATGAGAGG + Intergenic
957107779 3:75912630-75912652 TATTAGCTCCATCAGATACACGG + Intronic
957690695 3:83562799-83562821 TATTACTTTTAGTAGATATAGGG + Intergenic
958544044 3:95517813-95517835 TATTTCAGCTAGCAGAAAAAAGG + Intergenic
959347341 3:105215136-105215158 TATTAACTCTATAAGATATATGG + Intergenic
959494486 3:107033858-107033880 TATTTCCTCAAACTGATAAAAGG + Intergenic
961299670 3:125914841-125914863 TATTACCTCTTTCAGATGAGAGG - Intergenic
961888834 3:130113222-130113244 TATTACCTCTTTCAGATGAGAGG + Intronic
961974406 3:131008053-131008075 TAATACCTCTAGCTGATGCATGG - Intronic
962639002 3:137363736-137363758 TATTTCCTCAACCAGGTAAAGGG + Intergenic
968997981 4:3957141-3957163 TATTACCTCTTTCAGATGAGAGG + Intergenic
969756019 4:9151514-9151536 TATTACCTCTTTCAGATGAGAGG - Intergenic
969816349 4:9690679-9690701 TATTACCTCTTTCAGATGAGAGG - Intergenic
974977667 4:68910975-68910997 TATTTCCTCCAGCACTTAAATGG - Intergenic
975862168 4:78689339-78689361 TATCTACTCTAGCAGATAATAGG + Intergenic
978029219 4:103918048-103918070 TATTATCTCCAGCTAATAAAAGG - Intergenic
978729290 4:112006169-112006191 TATTACCTCCAGTAGTTAATGGG + Intergenic
978882752 4:113727017-113727039 AATTACCTCTAGCAAACATAGGG - Intronic
978898176 4:113915753-113915775 TTTTACCTGCAGCAGATGAAGGG - Intronic
979943670 4:126796735-126796757 TATTAACACTATCAGATATATGG + Intergenic
980887369 4:138778075-138778097 TATTAACTCTAGAAAAAAAAAGG + Intergenic
981155321 4:141428063-141428085 AATGACCTCTACCTGATAAAGGG + Intergenic
981441056 4:144782533-144782555 TATTACTTTTGGCAGATGAATGG - Intergenic
982084374 4:151818681-151818703 GATGACCTCTAGCTGATGAAAGG - Intergenic
982484017 4:155945487-155945509 TAATGCCTTTAGCTGATAAAAGG - Intronic
983007290 4:162499664-162499686 TACTGCCTCTAGTGGATAAAGGG - Intergenic
986364016 5:7011581-7011603 TATTACCATAAGAAGATAAAAGG + Intergenic
989762504 5:45035141-45035163 TCTTACCTCACTCAGATAAAGGG + Intergenic
990453414 5:55959588-55959610 TATTATCTATAGGAGAAAAAAGG + Intronic
990530559 5:56669530-56669552 AATATCCTCTAGCAGAAAAAAGG + Intergenic
991478001 5:67044137-67044159 AATTATCTCTAAGAGATAAAGGG - Intronic
991930115 5:71746017-71746039 AATTAATTCTAGCACATAAAAGG - Intergenic
992393427 5:76350213-76350235 TTTTTTCTCTAGCAGCTAAAGGG - Intronic
993793907 5:92242746-92242768 TATTATCCCTGGGAGATAAAAGG - Intergenic
995082099 5:108063921-108063943 TATTATCTCTTGGAGATAAATGG + Intronic
996867753 5:128146747-128146769 ATTTAGCTCTAGAAGATAAAAGG + Intronic
997823431 5:137085982-137086004 TATTACCTCTAGTCTATAGATGG - Intronic
997869473 5:137494695-137494717 AATTTCCTCTAGCAGACAAGAGG + Intronic
998528575 5:142864451-142864473 TTTCACCTCTGGCAGATGAAAGG - Intronic
999245188 5:150150445-150150467 TGGTACCTCTGGCAGATAAAAGG + Intronic
999618143 5:153447128-153447150 TATAAATCCTAGCAGATAAAAGG + Intergenic
1000653315 5:163845197-163845219 TCCTACCTCTAGCAGATGGAAGG - Intergenic
1001830403 5:174782458-174782480 TATTTCCTCAACCTGATAAAGGG - Intergenic
1003898379 6:10629817-10629839 TATTGCCTCTAACAGACACATGG + Intergenic
1008733339 6:54510547-54510569 TCTTTCCTCTAGTAGAGAAAGGG + Intergenic
1010597719 6:77785356-77785378 TATTACCACTTGGAGATAATAGG + Intronic
1011205047 6:84883376-84883398 TATTACTTACAGCAGTTAAAAGG + Intergenic
1012212501 6:96538824-96538846 TATTAAGATTAGCAGATAAAAGG - Intronic
1013055793 6:106581712-106581734 TATTACATTTGGCAGATAACTGG - Intronic
1013122334 6:107151803-107151825 TCTTCCCTCTAGCAGGTAACTGG + Intergenic
1013775150 6:113671117-113671139 TATTAACATTAGCAGAAAAATGG + Intergenic
1017020773 6:150138470-150138492 CATTACCTCAAGCAGATCTACGG - Intergenic
1017218336 6:151936351-151936373 GATTACGTTTAGTAGATAAAGGG - Intronic
1021826987 7:24563603-24563625 TAATACCTATGGCAGATAACGGG - Intergenic
1022837092 7:34128527-34128549 TTTTACTTCCAGCAGCTAAAGGG - Intronic
1023121030 7:36908834-36908856 TGTTGCCTCTAGCAGATAGGAGG - Intronic
1023272858 7:38484004-38484026 TATTAGATCAAGCAGAAAAAAGG + Intronic
1026244761 7:68609928-68609950 TCCTACCTCTAGTAGCTAAAAGG - Intergenic
1028515136 7:91670001-91670023 AATTTCCTTTGGCAGATAAAGGG - Intergenic
1032097064 7:128944476-128944498 TATTACCTATACAAAATAAATGG - Intronic
1035581168 8:739544-739566 TATTACCTTTCTCAGAGAAAAGG - Intergenic
1036379268 8:8226819-8226841 TATTACCTCTTTCAGATGAGAGG - Intergenic
1036850291 8:12195794-12195816 TATTACCTCTTTCAGATGAGAGG + Intergenic
1036871655 8:12438067-12438089 TATTACCTCTTTCAGATGAGAGG + Intergenic
1042492117 8:69411246-69411268 TATGATCTCTGGCAGATAATAGG - Intergenic
1042841282 8:73126373-73126395 TATTCCCTGTAGCACACAAATGG - Intergenic
1043109607 8:76163505-76163527 GATGAAATCTAGCAGATAAACGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1048661200 8:136603717-136603739 TTTTAACTCTAGGAGAAAAAAGG + Intergenic
1051711680 9:19936784-19936806 TATTATCTCAAGATGATAAATGG + Intergenic
1058476589 9:105340766-105340788 TATTACCTCTAGAAATTAAAGGG + Intronic
1059002362 9:110362357-110362379 TACTACCTATATCATATAAATGG - Intergenic
1059950695 9:119459480-119459502 TATCACATCTAGCATATAATAGG + Intergenic
1060168280 9:121439086-121439108 TTTTACCTTTATCAGGTAAATGG - Intergenic
1186046358 X:5541140-5541162 TCTTACCTCTATCAGATGGAAGG - Intergenic
1187920620 X:24197962-24197984 TATTGAATCTAGCAGATGAAAGG + Intronic
1188032097 X:25275568-25275590 TATTACCTCAATCAGAGGAATGG - Intergenic
1189147080 X:38666447-38666469 TTTTACCTCTAGGGGATTAAAGG - Intronic
1189147402 X:38669268-38669290 TATAGCCTCTATCACATAAAAGG - Intronic
1193696521 X:84713339-84713361 TATTTCCTTTAGAAGGTAAATGG + Intergenic
1195333707 X:103829403-103829425 TTTTACTTCTAGAAAATAAATGG - Intronic
1197486516 X:127057561-127057583 TCTTACCTCAAACAGACAAAAGG - Intergenic
1197661370 X:129177802-129177824 TAATAATTCTATCAGATAAATGG - Intergenic
1198735566 X:139781340-139781362 TATTATTTCAAGCAGATCAATGG + Intronic
1200013126 X:153135556-153135578 CATTACCACCAACAGATAAATGG - Intergenic
1200026474 X:153264367-153264389 CATTACCACCAACAGATAAATGG + Intergenic