ID: 933012360

View in Genome Browser
Species Human (GRCh38)
Location 2:77083462-77083484
Sequence CCAACCATTGATTTTAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933012357_933012360 30 Left 933012357 2:77083409-77083431 CCATAGACTGAAGTCAGAACTTG 0: 1
1: 0
2: 2
3: 18
4: 228
Right 933012360 2:77083462-77083484 CCAACCATTGATTTTAACAGTGG 0: 1
1: 0
2: 1
3: 5
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933012360 Original CRISPR CCAACCATTGATTTTAACAG TGG Intronic
904109613 1:28115407-28115429 GCAACCATTAATCTTAACAAGGG - Intergenic
907144922 1:52223096-52223118 CCCACCATTAAATTTATCAGGGG + Intronic
907790149 1:57655523-57655545 CCAAACACTGATTTGAACACTGG + Intronic
909802764 1:79833288-79833310 TCAACCATTGTTCTTAATAGTGG + Intergenic
912065671 1:105738298-105738320 CTAACAATTGTTTTTCACAGTGG + Intergenic
915925542 1:160016008-160016030 ACAACCTTAGATATTAACAGTGG + Intergenic
917646429 1:177033296-177033318 TCAATCATAGATTCTAACAGTGG + Intronic
921708822 1:218353107-218353129 CATGCCATTGATTTTAAGAGAGG + Intronic
1065447355 10:25816840-25816862 CCAAACACTGCTTTTCACAGTGG - Intergenic
1067677287 10:48392946-48392968 AATAGCATTGATTTTAACAGAGG - Intronic
1072078390 10:92002330-92002352 TCAACCAGTGATTTTTATAGAGG + Intronic
1072171868 10:92871042-92871064 AGATCCATTGATTTTCACAGGGG - Intronic
1073210473 10:101797422-101797444 CCAAGTATTGGTTTTACCAGGGG - Intronic
1073902881 10:108244349-108244371 CCAACCCTTGATGGTAATAGGGG - Intergenic
1076703682 10:132289350-132289372 TCAACCATTCATTTTCTCAGCGG - Intronic
1079381656 11:19943616-19943638 CCAACAATTGCCATTAACAGGGG - Intronic
1081681143 11:45004291-45004313 ACAACCACTGCTTTTAACTGGGG + Intergenic
1085853380 11:80148026-80148048 CCACCCTTTGTTTTTGACAGTGG - Intergenic
1090223953 11:125057599-125057621 CGAACCAGGGATGTTAACAGAGG - Intergenic
1093305014 12:17505602-17505624 AGTAACATTGATTTTAACAGTGG + Intergenic
1094674180 12:32602285-32602307 TCAACCACTGATTTGAACTGGGG - Exonic
1096868545 12:54579053-54579075 CCAACCATGCATTTGTACAGTGG + Exonic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1100958399 12:99935522-99935544 GCAACCAGTGATGTTAAAAGAGG - Intronic
1101761063 12:107659548-107659570 CCAGGCATTGATTTGTACAGTGG + Exonic
1103980438 12:124733633-124733655 CCAACCTTTGATGTTTTCAGGGG + Intergenic
1109192040 13:59336951-59336973 CCAACCATTGAGTTTCAAACTGG - Intergenic
1110816193 13:79862450-79862472 CCAACCATTGTATTTAAAAGGGG + Intergenic
1111746551 13:92277659-92277681 TCAACCATTTAATTTTACAGGGG - Intronic
1112443304 13:99441276-99441298 CAATCCATTGATTTTAAATGTGG + Intergenic
1114970472 14:28020945-28020967 CCAACTATTGATTTAAAGAAAGG - Intergenic
1116087250 14:40255778-40255800 AGAACCAGTGATTTTAACAAGGG + Intergenic
1116222422 14:42105250-42105272 TTAACCATTTATTTTGACAGAGG - Intergenic
1118650805 14:67892433-67892455 TAAACCATTCATTGTAACAGTGG - Intronic
1125144513 15:36451224-36451246 CCAACCATTTATTTTACCCATGG + Intergenic
1126977065 15:54195270-54195292 CCAGCCAATGATGTAAACAGGGG - Intronic
1128334425 15:66777085-66777107 CCAACACATGTTTTTAACAGGGG - Intronic
1130289811 15:82588842-82588864 CCCATCATTGATTTAAACAATGG - Intronic
1131205516 15:90442482-90442504 TCAACCACTAATTTTAACAAGGG - Intronic
1131606411 15:93908512-93908534 CAAACAATTGAGTTTACCAGTGG + Intergenic
1135258970 16:20964808-20964830 CCAACCACTGATTTTGGCACTGG + Exonic
1135659218 16:24280034-24280056 CCAACCACTAATTCTAACAGAGG + Intronic
1136864492 16:33734399-33734421 ACAAACATTCATTTAAACAGAGG + Intergenic
1203125985 16_KI270728v1_random:1582534-1582556 ACAAACATTCATTTAAACAGAGG + Intergenic
1143545412 17:7592424-7592446 CGAACCCCTGATTTTCACAGGGG + Intronic
1149556475 17:57576990-57577012 CCAGGCATTTATTTTAAGAGGGG + Intronic
1151139559 17:71978454-71978476 GCCTCCATTGTTTTTAACAGTGG + Intergenic
1152800751 17:82329671-82329693 CCACCCCTTGATTTTAACCCAGG - Intronic
1153847063 18:9059675-9059697 CCCACCAGTGATTTCATCAGTGG - Intergenic
1157971616 18:52276228-52276250 ACAAACATTTATTTTAACAAAGG - Intergenic
1158174491 18:54638974-54638996 ACACCTATTGATTTTTACAGAGG + Intergenic
1158604128 18:58879752-58879774 CCAACGATTGTTTTTTTCAGTGG + Intronic
1158986684 18:62824888-62824910 CCCCCCATTTTTTTTAACAGTGG + Intronic
1159727530 18:71980264-71980286 CCAATTAATAATTTTAACAGAGG + Intergenic
1165877231 19:39016873-39016895 CCAGCATTTGATTTTAACAAGGG + Intronic
1167215053 19:48159010-48159032 CATACCAGTGATTTGAACAGAGG - Intronic
1168316675 19:55487646-55487668 CCAACAATTAATGTTAACTGGGG - Intergenic
926806227 2:16714367-16714389 CCAACCATGAATTGGAACAGAGG + Intergenic
928878994 2:36075645-36075667 CCAACCTTTGATTTTATAATAGG + Intergenic
929413022 2:41718484-41718506 AAAAGCATTGATTTTAACATGGG + Intergenic
929610926 2:43270114-43270136 CCAAGCCTTGATTTATACAGAGG - Intronic
933000576 2:76917434-76917456 CGAAACATAGATTTTAATAGAGG - Intronic
933012360 2:77083462-77083484 CCAACCATTGATTTTAACAGTGG + Intronic
933156907 2:78986081-78986103 CAAAACATTTATTTTAAAAGAGG + Intergenic
938623902 2:133087615-133087637 CTAGCCATTTATTTTGACAGTGG + Intronic
1169732289 20:8799299-8799321 GCAAACAATGATTTTAACACCGG + Intronic
1171253097 20:23665036-23665058 CCAACCACTGATTTTCACCTTGG - Intergenic
1171259586 20:23720350-23720372 CCAACCACTGATTTTCACCTTGG - Intergenic
1171268652 20:23795810-23795832 CCAACCACTGATTTTCACCTTGG - Intergenic
1173955622 20:47030348-47030370 CCAACCACTGGTTTACACAGTGG + Intronic
1174797966 20:53538404-53538426 CGAAACATTGATTTATACAGAGG - Intergenic
1175474444 20:59261071-59261093 CCACCCAGTTATTTTAACAAGGG - Intergenic
950895498 3:16446573-16446595 TCAACCTTTGATTTTCCCAGTGG - Intronic
951681302 3:25297685-25297707 CCATCTCTTGCTTTTAACAGGGG - Intronic
952827529 3:37536807-37536829 CATACCAGTTATTTTAACAGAGG + Intronic
953860371 3:46539265-46539287 CCAAGCATTTATTTTAAAACAGG + Intronic
958538838 3:95441913-95441935 CCATAACTTGATTTTAACAGAGG + Intergenic
962636138 3:137333479-137333501 CCAAGCAGTGATTTGAACACAGG + Intergenic
966072901 3:175901050-175901072 CCTAACATTGATTTTTACAAAGG + Intergenic
966495260 3:180572959-180572981 CCAAGCAGAGATTTTAGCAGAGG - Intergenic
968339068 3:197939662-197939684 ATAACCATTTATTTTACCAGTGG - Intronic
970806016 4:20032974-20032996 CAAACCTCTGATGTTAACAGAGG + Intergenic
971076849 4:23158977-23158999 CAAAACATTAATTTTAACAAAGG + Intergenic
971198067 4:24488131-24488153 CCAACAAGTGATTTTCAGAGAGG + Intergenic
972726902 4:41752398-41752420 CCTACTATTTATTTTAATAGAGG + Intergenic
974275523 4:59715978-59716000 CCATCGAGTGATTTTAATAGTGG - Intergenic
978237871 4:106481846-106481868 CAAAACATTGATTTTAATATTGG - Intergenic
979283840 4:118898571-118898593 ACAATCATTTTTTTTAACAGTGG + Intronic
983408741 4:167368761-167368783 CAAACCATTGAATATAGCAGTGG + Intergenic
989698563 5:44234116-44234138 CCACCCAGAGATTTGAACAGTGG + Intergenic
990632687 5:57688113-57688135 CTGATCATTGATTATAACAGAGG - Intergenic
991292141 5:65043404-65043426 GCAACATTTGCTTTTAACAGAGG - Intergenic
992800724 5:80293432-80293454 CAAACCATTGATTTGAAAAGGGG + Intergenic
993994452 5:94705343-94705365 GCAACCAATGACATTAACAGAGG - Exonic
994212434 5:97101678-97101700 CCCAACATTGTTTCTAACAGAGG - Intronic
994338614 5:98599653-98599675 TCATCCAATGATTTTAACACTGG - Intergenic
994342609 5:98649211-98649233 CTACCCATTTATTTTAACATTGG - Intergenic
995938335 5:117546620-117546642 CTAACCACTGATTTTTATAGAGG - Intergenic
997219484 5:132148971-132148993 CCAAGCATTCATATTATCAGGGG + Intergenic
997615398 5:135242828-135242850 CGAACCATTGATTTAAAAACAGG - Intronic
1005385006 6:25277838-25277860 CCAACCATTTGTTTCAAAAGTGG - Intergenic
1005448099 6:25946172-25946194 CCAACAATTCATTTAAAAAGTGG - Intergenic
1005828013 6:29647251-29647273 CCAGCCAATGATTTTAAAACTGG + Intergenic
1006209571 6:32384160-32384182 TCAACCTTTGATCCTAACAGAGG + Intergenic
1007029618 6:38616218-38616240 CCAACCACTGAGCTTAATAGAGG + Intronic
1012149585 6:95730922-95730944 CCAATTATTGATTTTGCCAGTGG - Intergenic
1013293690 6:108740147-108740169 CCCGCCATTGATTTTCACAAAGG + Intergenic
1014492280 6:122077301-122077323 CCAACCATTTTTCTTAACATGGG - Intergenic
1017151399 6:151283740-151283762 CCTGACATTGCTTTTAACAGTGG - Intronic
1018496506 6:164352317-164352339 CCTACCATTAATTTAAAAAGAGG - Intergenic
1021391620 7:20100296-20100318 CTTGCCATTAATTTTAACAGCGG - Intergenic
1023118475 7:36885620-36885642 CCAAACATTGATTTTTCCAAAGG + Intronic
1023244509 7:38186925-38186947 CCAACCTTTTATTCTCACAGTGG - Intronic
1023799523 7:43821826-43821848 CCATACATTTATTTTACCAGAGG + Intergenic
1026368771 7:69676954-69676976 CTCATCATTCATTTTAACAGTGG + Intronic
1027638171 7:80701898-80701920 CCAAACAATGATGTTAAGAGGGG - Intergenic
1028778608 7:94708015-94708037 CCAGCCAATGATTCTAAGAGGGG - Intergenic
1030732144 7:113002951-113002973 CCAACCTCTGTTTTTATCAGAGG + Intergenic
1030898903 7:115097188-115097210 CCAACCATTGATATTTACAAAGG - Intergenic
1035969860 8:4235847-4235869 CCATCCTTTGATTCTAACTGAGG + Intronic
1037793920 8:21975348-21975370 CCAACTTTCGATTTTAACACAGG - Intronic
1041503308 8:58563615-58563637 CCATATAGTGATTTTAACAGTGG + Intronic
1044065980 8:87700772-87700794 CTAACATTTGATTTTAACACTGG + Intergenic
1045675462 8:104602878-104602900 CCAAGCATTTATTTTAAAAATGG + Intronic
1046307386 8:112386796-112386818 CCAACTAAAGATTTTAAAAGAGG + Intronic
1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG + Intronic
1050613419 9:7376855-7376877 CCAATTTTTGATGTTAACAGAGG - Intergenic
1051951993 9:22647202-22647224 CTTAGCATTGCTTTTAACAGGGG + Intergenic
1052120451 9:24709240-24709262 CCAACCATTATTTTTAAAATTGG + Intergenic
1052298239 9:26923237-26923259 GCAACCATTGATTCTAAAACTGG - Exonic
1053189797 9:36054025-36054047 CCGACCATTGAGTTTAGTAGGGG - Intronic
1055146943 9:72947191-72947213 CCAATCATTGATTTTAATAGTGG - Intronic
1057558238 9:96106186-96106208 CCAGCTATTTTTTTTAACAGAGG + Intergenic
1058574283 9:106383262-106383284 CCAACGATTGCTCTTAATAGGGG + Intergenic
1186475568 X:9854670-9854692 CCCACGATTGTTTTTAAGAGTGG + Intronic
1188980016 X:36718965-36718987 CCAACCATGGTTTTCAACAATGG + Intergenic
1194242451 X:91469131-91469153 TGATCCATTGATTTTTACAGAGG - Intergenic
1195333331 X:103825207-103825229 CACACCATTGACTTGAACAGTGG - Exonic
1195779229 X:108442064-108442086 CAAACCCTTGGTTTTAATAGAGG - Intronic
1201553351 Y:15242157-15242179 CCAAGCTTTGATATAAACAGAGG - Intergenic