ID: 933017702

View in Genome Browser
Species Human (GRCh38)
Location 2:77150512-77150534
Sequence TGAGATCTTAAAATGAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933017702 Original CRISPR TGAGATCTTAAAATGAATGA GGG (reversed) Intronic
902114916 1:14113466-14113488 TGAGATCTGAAAGAGAAGGAAGG + Intergenic
905124372 1:35707099-35707121 AGAGATCTTAAACTGGAGGAGGG + Intergenic
905921100 1:41719409-41719431 TGAGTTATTCATATGAATGAAGG - Intronic
907960644 1:59277523-59277545 TGAGTTTTAAAAATGAATAATGG - Intergenic
908219561 1:61991272-61991294 TGAGATCACAAAGTAAATGATGG + Intronic
908222192 1:62018697-62018719 TGAAATATCACAATGAATGAGGG - Intronic
908588326 1:65598888-65598910 TGAGGCCTTAAAATGAAAGGAGG + Intronic
908859761 1:68470911-68470933 TAAGATCTAAAGATGAATGCAGG + Intergenic
909236692 1:73161764-73161786 TGAGATTTTAAAATAAAATAAGG + Intergenic
909706280 1:78588485-78588507 CAGGGTCTTAAAATGAATGAGGG - Intergenic
909790168 1:79666909-79666931 TGAGAACTTTAAGTGAATGTGGG + Intergenic
911003003 1:93186669-93186691 TTATATCTGAAAATGATTGAAGG + Intronic
911112044 1:94199437-94199459 TGACATCTTAAAAAGCATGCTGG + Intronic
911577970 1:99600520-99600542 TGAGATCTGAAAAAGACTGCAGG + Intergenic
911665152 1:100543470-100543492 TGAGATGTTAAAATGGAGGGGGG - Intergenic
911826318 1:102489580-102489602 TGAGTTCTACAAAGGAATGAAGG + Intergenic
912271364 1:108212540-108212562 TGATATCTTAAAATGAAAGCTGG - Intergenic
913423086 1:118695208-118695230 TGACCTCATAAAATGAATTAGGG - Intergenic
914404824 1:147360046-147360068 TGGCATCATAAAATGAATTAGGG - Intergenic
914952391 1:152127929-152127951 TGAGATCATAAACTGATAGAGGG + Intergenic
917308487 1:173652602-173652624 TGACATCATAAAATGAGTTAGGG + Intronic
917594334 1:176513970-176513992 TGCCATCTCAACATGAATGAGGG + Intronic
917647547 1:177044144-177044166 TCATTTCTTAAAATTAATGATGG - Intronic
917714377 1:177719430-177719452 TGGGGTCATAAAATGAATTAGGG + Intergenic
918317887 1:183338247-183338269 TGAGTTCTTCAGATGAATCAGGG + Intronic
918602684 1:186382059-186382081 GGAGATCTAAAAATAAATGTAGG - Intronic
918656578 1:187034009-187034031 TGAGTCCTTATAAGGAATGATGG - Intergenic
919121779 1:193349911-193349933 TGAGATCTTTAAATGCATTTAGG + Intergenic
920738254 1:208555077-208555099 TGAGCTCATAAAAAGGATGAGGG - Intergenic
921594971 1:217044930-217044952 TGAGATATTAAAACTAATCACGG + Intronic
921600893 1:217105325-217105347 TGTGATGTTAAAAATAATGAAGG - Intronic
922400390 1:225248084-225248106 TAATATCTTCAAATGGATGAAGG + Intronic
923117306 1:230954671-230954693 TGGGATTTGAAAATGAATGATGG - Intronic
923222903 1:231912661-231912683 TCAGATCTTAAACTGCATGCTGG + Intronic
923294082 1:232576065-232576087 AGAGGTCTGAAAATGGATGATGG + Intergenic
1063320712 10:5050335-5050357 TGAAATTTTAAAATCAAAGAAGG + Intronic
1063674131 10:8124731-8124753 TGACATATGAAAATGAATGGAGG + Intergenic
1063777261 10:9278022-9278044 AGAGATTTTAAATTGAATAATGG + Intergenic
1063826334 10:9902353-9902375 TGAGATGTCAAAATTAATCAAGG + Intergenic
1065160101 10:22910923-22910945 TAAAATCTTGAAATGAGTGATGG + Intergenic
1065416868 10:25497727-25497749 TTAGATCTTAAACTCCATGAAGG - Intronic
1065913199 10:30328696-30328718 AGAGATCTCCAAATGAATGTGGG - Intronic
1066444235 10:35466947-35466969 TTAAATCTTAAAATGAAAGTAGG + Intronic
1067988050 10:51174470-51174492 TGAGAACTTAAAATTAAATAGGG + Intronic
1068554069 10:58438477-58438499 AGAGCTCATAAAATGCATGATGG + Intergenic
1068670483 10:59717378-59717400 TGAGATCTCTAAATGAACGTGGG - Intronic
1068711943 10:60144776-60144798 TGGAATCTAAAAAGGAATGAGGG - Intronic
1068971705 10:62965044-62965066 AAAGTTCTTAAAAAGAATGATGG - Intergenic
1069017669 10:63448455-63448477 TGATATTTTAAAATGTATTAGGG - Intronic
1070691388 10:78529486-78529508 TGAGATGTGCCAATGAATGATGG - Intergenic
1071982788 10:91020610-91020632 TGAGATCTCCAAAAGAATGAGGG + Intergenic
1072632441 10:97155581-97155603 GGAGATTTTAAAATCAATGAGGG + Intronic
1077781491 11:5334892-5334914 TGAGATTTTAAAATGAGTATGGG + Intronic
1078369207 11:10731082-10731104 TGAGGTCTAAACATGTATGAGGG - Intergenic
1080171843 11:29313323-29313345 TTGGATCTTGAAATGAATGTTGG + Intergenic
1080509098 11:32949142-32949164 TGAGATACAAGAATGAATGAAGG - Intronic
1081018812 11:37916832-37916854 TGAGAACTTAAATAAAATGAAGG - Intergenic
1081363622 11:42209003-42209025 TGGCCTCTTAAAATGAATTAGGG - Intergenic
1082705777 11:56492865-56492887 TGATATATAAAAATGAATGAGGG - Intergenic
1082706947 11:56503709-56503731 TGATATATAAAAATGAATGAAGG - Intergenic
1082742921 11:56930792-56930814 TGAGATCTGAAAGTGAGTGGCGG - Intergenic
1082912611 11:58393842-58393864 TGAGACCTTAATAAAAATGAGGG - Intergenic
1084691747 11:70731581-70731603 TCAGCCCTTAAAAGGAATGAGGG - Intronic
1085683075 11:78596260-78596282 AGTCATTTTAAAATGAATGATGG + Intergenic
1086559099 11:88146484-88146506 TCTGATCTCAAAATGAAGGAAGG + Intronic
1087156697 11:94911529-94911551 TGTGAACTTAAAATGAATGAAGG + Intergenic
1087363368 11:97188857-97188879 AGAGAGCTTCAAATGAAAGAGGG - Intergenic
1087436085 11:98119322-98119344 TGAGCTCATAAAATGATTTAGGG + Intergenic
1087934409 11:104015853-104015875 TGAGCTCTTTATATGCATGAAGG - Intronic
1087954512 11:104268338-104268360 TGACATCATAAAATGAGTTACGG - Intergenic
1088409782 11:109521459-109521481 TGAGATACTAAAATCAATGAAGG + Intergenic
1090518900 11:127458045-127458067 TGAGAGCCTAAAATGCATAAAGG - Intergenic
1090873677 11:130770034-130770056 TAAGGTCATAAAATTAATGAGGG + Intergenic
1092580208 12:9833371-9833393 GGAGATCTAAAAGTGAATAATGG + Exonic
1093346905 12:18049087-18049109 TGATATCTTAAAATCAATTATGG - Intergenic
1095118915 12:38390272-38390294 TGAGCTTTTAAAATATATGATGG - Intergenic
1095671743 12:44869475-44869497 TGAGAGAATAAAATGAAAGAAGG - Intronic
1096260322 12:50086061-50086083 TGAGATCTTTGAATGAAGTAAGG - Intronic
1097626407 12:62006806-62006828 GGAGATATTAAAATGGTTGATGG - Intronic
1097751029 12:63353196-63353218 TTAGTTCTTAAAATATATGATGG + Intergenic
1098120212 12:67228598-67228620 TGGCATCATAAAATGAATTAGGG + Intergenic
1099417563 12:82410779-82410801 TGAGATCTAAAAACTAATAATGG + Intronic
1099647508 12:85378180-85378202 TGAACTACTAAAATGAATGAAGG - Intergenic
1099655791 12:85488628-85488650 CCAGATCTTAAAATGAAGGAAGG - Intergenic
1099835928 12:87909877-87909899 TGAGATCTAAAACAGAATAATGG + Intergenic
1100750546 12:97693816-97693838 TGGCCTCATAAAATGAATGAGGG + Intergenic
1100766277 12:97869181-97869203 TGGCCTCATAAAATGAATGAGGG - Intergenic
1101160542 12:101969939-101969961 TTAGTTCTTAAAATGTTTGATGG - Intronic
1102119958 12:110432480-110432502 TGTAATCTTGAAATGAATCAGGG + Intergenic
1104467337 12:129001303-129001325 TGATATTTTAAAATGAATTAAGG + Intergenic
1106160372 13:27195978-27196000 TGAGATCTTAAAATGCAGAAAGG - Intergenic
1106524831 13:30531240-30531262 TTAAAAATTAAAATGAATGATGG + Intronic
1108974887 13:56427863-56427885 TAAGCTCATAAAATTAATGAAGG - Intergenic
1110383401 13:74879852-74879874 TGATATCTTCAAGTGAATGGGGG - Intergenic
1110577469 13:77075501-77075523 TTAGATCTGAAAGAGAATGAAGG - Intronic
1110746537 13:79060339-79060361 TGATATCCTAAAATGACTGCTGG + Intergenic
1110881848 13:80581279-80581301 TGACTTCATAAAATGAATTAAGG - Intergenic
1111393609 13:87633245-87633267 TGGCCTCTTAAAATGAATTAGGG + Intergenic
1111719616 13:91925652-91925674 TGAGGTCTTATTATGAATCAGGG + Intronic
1111781964 13:92739919-92739941 TGGGTTCTGAAAATGAATTAGGG - Intronic
1112144520 13:96682724-96682746 TGATATTTTAAAATAAATGATGG + Intronic
1112867353 13:103921699-103921721 GTAGATATTAAAATGTATGAAGG + Intergenic
1114137031 14:19864825-19864847 AGAGATCTAATAATGAATAAAGG - Intergenic
1114426275 14:22626250-22626272 TGACATCTAAAAATGAATTATGG + Intergenic
1116064476 14:39965255-39965277 TGAGATATTTAAATGGATTATGG + Intergenic
1116182327 14:41550913-41550935 CGTGTTCTTAAAATAAATGATGG + Intergenic
1116226408 14:42159132-42159154 TGACATTGTAAAAAGAATGAAGG + Intergenic
1116622919 14:47228699-47228721 TGACATATTATAATGAAAGAAGG + Intronic
1116794099 14:49371319-49371341 TGAGATCTTACATTGCATAAAGG - Intergenic
1117221998 14:53615877-53615899 TGAGAGCTTACAATGAAGGTAGG - Intergenic
1117513963 14:56482089-56482111 AGAAATCCTAACATGAATGAAGG - Intergenic
1120010150 14:79404642-79404664 TGAGATTTAAAAATGTATAAAGG + Intronic
1120339183 14:83197161-83197183 TGAGATTCTAAAAATAATGATGG - Intergenic
1122827956 14:104380635-104380657 TGAGATGTGAAAATGGCTGACGG + Intergenic
1202842541 14_GL000009v2_random:135655-135677 TGACCTCATAAAATGAATTAGGG + Intergenic
1123700316 15:22909922-22909944 CCAGAGCTTAAAAAGAATGAAGG - Intronic
1123739666 15:23224889-23224911 TGAGGTCTTATTATGAATCAGGG + Intergenic
1124290890 15:28453865-28453887 TGAGGTCTTATTATGAATCAGGG + Intergenic
1125915829 15:43486427-43486449 TGAGTTCTGATAATGAAAGATGG - Intronic
1127323539 15:57871271-57871293 TGAGAGTTTATCATGAATGAGGG - Intergenic
1127693508 15:61421012-61421034 TGAGATTTTAAACTTAATCAGGG - Intergenic
1128415358 15:67440353-67440375 TGACTTCATAAAATGAATTAGGG - Intronic
1130514789 15:84617964-84617986 TGTGATCTTAAATTGACTGAAGG + Intronic
1131403456 15:92144911-92144933 AGAGATGGTAAAATGAAGGAAGG + Intronic
1133338919 16:5024188-5024210 AGAGATTTTAAAATAAATAAGGG - Intergenic
1135072365 16:19363193-19363215 TAAGATATTAATATAAATGATGG - Intergenic
1135131804 16:19859622-19859644 GGAGCTCTTGAAATGAATAAGGG + Exonic
1135293412 16:21259623-21259645 TTAGATTTTCAAATGAATGGGGG - Intronic
1136707875 16:32203792-32203814 TGAGGTCTTATTATGAATCAGGG - Intergenic
1136760034 16:32725619-32725641 TGAGGTCTTATTATGAATCAGGG + Intergenic
1136808070 16:33144767-33144789 TGAGGTCTTATTATGAATCAGGG - Intergenic
1137335942 16:47549184-47549206 TGAGAACTTAATTTGGATGAGGG - Intronic
1138967461 16:62102115-62102137 TGTGATCTTCACATGAGTGAAGG + Intergenic
1140645106 16:77021401-77021423 TGATATCTTAAAATCATTGGGGG - Intergenic
1203062190 16_KI270728v1_random:985940-985962 TGAGGTCTTATTATGAATCAGGG + Intergenic
1143741856 17:8960178-8960200 TGAGATGTTGAAAAGAATGCTGG + Intronic
1148058599 17:44818277-44818299 TAAGATCTTAAAATGTAAAATGG + Intronic
1148776159 17:50096727-50096749 TGAGACCTTCAAAAGGATGATGG + Intronic
1149689205 17:58559965-58559987 TAAGATGATAAAATAAATGATGG - Intronic
1149897904 17:60444451-60444473 TGCGATCTTAGAAATAATGAAGG - Exonic
1150298884 17:64031819-64031841 TGACATCTCAAAATAAATGGGGG + Intergenic
1152997367 18:420250-420272 TGAGATGATAAAATGTTTGATGG + Intronic
1155409464 18:25526523-25526545 TGACCTCATAAAATGAATTAGGG + Intergenic
1156067174 18:33157707-33157729 CGAGATCTTAAAATCAATATAGG - Intronic
1156737301 18:40275880-40275902 AGAGCTCTTTAAATGCATGAAGG - Intergenic
1156747373 18:40408480-40408502 TCCTATTTTAAAATGAATGAAGG - Intergenic
1157458717 18:47864020-47864042 TGACATTTAAAAGTGAATGATGG - Intronic
1157748462 18:50157789-50157811 TTAGATCATAAGATGTATGAGGG + Intronic
1157866256 18:51187761-51187783 TGATATATAAGAATGAATGAAGG + Intronic
1158210375 18:55042452-55042474 TGACCTCATAAAATGAATTAGGG - Intergenic
1158243071 18:55399380-55399402 TTACATCTTAAAATGACTAATGG - Intronic
1159289693 18:66400396-66400418 TGAGAACTAAGAATGATTGATGG + Intergenic
1159734720 18:72080958-72080980 TCATATCTCAAAATGAATCAAGG + Intergenic
1159991798 18:74917432-74917454 TGAGATTTTAAAAGGCATTAAGG - Intronic
1160095562 18:75869221-75869243 TGAGATCTTAATAGACATGATGG - Intergenic
1164799516 19:31064641-31064663 TTAGAGCTCATAATGAATGATGG + Intergenic
1164820855 19:31250123-31250145 TGACATCTTAAAAGCACTGAAGG + Intergenic
1164848183 19:31452349-31452371 TCAGATCTGAAACTGAAAGATGG - Intergenic
1167603282 19:50466807-50466829 TGAGATATTAAAGTTAATAAAGG - Exonic
1167837237 19:52084207-52084229 TCATATTTTAAAATCAATGATGG + Intronic
1167846244 19:52167168-52167190 TTATATTTTAAAATCAATGATGG + Intronic
1167981548 19:53280443-53280465 TGAGATTTTAAAGGGAATGCTGG - Intergenic
1167984541 19:53303198-53303220 TGAGATTTTAAAGGGAATGCTGG + Intergenic
1168461315 19:56560969-56560991 TTAGATGTTACAATTAATGAAGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926834587 2:17004183-17004205 TGAGATCTTAGAAAGTAAGATGG - Intergenic
926954660 2:18281250-18281272 TGGGGTCTTAAAATTAATGCGGG - Intronic
928139491 2:28715986-28716008 TACACTCTTAAAATGAATGATGG + Intergenic
928622283 2:33102541-33102563 TGAGAAATTAAAATGAAAGAAGG - Intronic
928707388 2:33964869-33964891 TGAGTTCTTTAATTGAATCATGG + Intergenic
928779542 2:34803447-34803469 TGAGATCTAAAACAGAATAATGG + Intergenic
928991856 2:37240693-37240715 AGAGCCCTTAAAATGTATGAAGG + Intronic
929573932 2:43040508-43040530 TGAGATCTGAAAAAGAATCTGGG - Intergenic
929619265 2:43337982-43338004 TGATAACTTCAGATGAATGATGG + Intronic
929626021 2:43407854-43407876 TGGGAACATAAAAAGAATGATGG + Intronic
930158207 2:48127026-48127048 TTAAATCTTAAGATCAATGAAGG - Intergenic
930472611 2:51838605-51838627 TGAAAAATTAAAATGGATGAAGG + Intergenic
930755828 2:54971046-54971068 TTAAATCTTAAGATAAATGAGGG + Exonic
930854674 2:56001083-56001105 TGAGAAAAAAAAATGAATGATGG - Intergenic
930854750 2:56002412-56002434 TGAGAAAAGAAAATGAATGATGG - Intergenic
931061524 2:58534778-58534800 TGAGATTTTAAAATGTAAGAGGG + Intergenic
931147081 2:59530976-59530998 TGAGATTCTTAAATGAAAGATGG + Intergenic
931993186 2:67811185-67811207 TGGCTTCATAAAATGAATGAGGG - Intergenic
933017702 2:77150512-77150534 TGAGATCTTAAAATGAATGAGGG - Intronic
933226781 2:79758998-79759020 TCAGATCTTACAATAAATTATGG + Intronic
933232401 2:79824046-79824068 TGAGATCTTGAAAAGCATGTAGG + Intronic
933247591 2:79993465-79993487 TGAGATCTTAAGATGCCCGAGGG - Intronic
934133048 2:88968101-88968123 TGAGTTCTTCAAAGGAAGGAAGG - Intergenic
934549612 2:95248892-95248914 TTTGATTTTAAAAAGAATGAAGG - Intronic
934980280 2:98833774-98833796 TGAGATCTGATGATGAAGGAAGG + Intronic
936606485 2:113962260-113962282 AGAGATTTTGAAATGACTGAAGG - Exonic
936645176 2:114360594-114360616 TGAGGCCTGAAAATGGATGAAGG + Intergenic
936823841 2:116556404-116556426 TGGCATCATAAAATGAATTAGGG - Intergenic
938231022 2:129659179-129659201 TTAGATCTGAAGATTAATGAGGG + Intergenic
939106606 2:137955858-137955880 TTAGAACTGGAAATGAATGATGG + Intergenic
939436776 2:142187035-142187057 TGAAATCTTAAAAAAAAAGAGGG - Intergenic
939664659 2:144936252-144936274 TTAAATTTTAAAATTAATGATGG + Intergenic
939796043 2:146645468-146645490 TGGCATCATAAAATGAATTAGGG - Intergenic
942022806 2:171883698-171883720 TGAGAACTAAAAGGGAATGAGGG - Intronic
942331880 2:174834560-174834582 TGACATCTTCAAAGGACTGAAGG - Intronic
942797101 2:179834518-179834540 TGATATTTTAAAACGAAAGACGG + Intronic
943305128 2:186252173-186252195 TGACCTCATAAAATGAATGAGGG + Intergenic
945004036 2:205384091-205384113 TGGAATGTTAAAATGACTGATGG - Intronic
1168882589 20:1220357-1220379 TGACCTCATAAAATGAATTAGGG - Intergenic
1169477973 20:5949836-5949858 TGAGATCCTAAAGTGAAGAAAGG + Intronic
1172144886 20:32750081-32750103 GGACATTTTAAAGTGAATGAAGG - Intergenic
1172930273 20:38581472-38581494 CGAGCACTTAAAATGACTGAAGG - Intronic
1173064955 20:39701840-39701862 TGTGATGTGAAAATGAATGCAGG + Intergenic
1173243010 20:41314672-41314694 TGTGGTCTTAAAAAGAATTACGG - Intronic
1174775138 20:53336476-53336498 TGAGATCTTACAATGAATTCAGG - Intronic
1174992431 20:55526111-55526133 TGATGGCTTAAAAAGAATGATGG - Intergenic
1175422364 20:58842363-58842385 TGAGGGCTTGAGATGAATGACGG + Intronic
1176344131 21:5725560-5725582 TGACCTCATAAAATGAATTAGGG + Intergenic
1176350945 21:5846144-5846166 TGACCTCATAAAATGAATTAGGG + Intergenic
1176500696 21:7598896-7598918 TGACCTCATAAAATGAATTAGGG - Intergenic
1176538452 21:8123629-8123651 TGACCTCATAAAATGAATTAGGG + Intergenic
1176913442 21:14596571-14596593 TTAGATCTTAAAAGGAATTGTGG + Intronic
1177540806 21:22491827-22491849 AGAGTTCTGAAAATGAATGATGG + Intergenic
1177922646 21:27171732-27171754 TATGATCTTAAAATGAAGGGTGG - Intergenic
1178482133 21:32988963-32988985 TAAGATTTCAAAAGGAATGAAGG - Intergenic
1178979563 21:37251391-37251413 TCAGTTCTTAAGATAAATGAAGG - Intronic
1179328214 21:40371740-40371762 TGAGATGTTTACAGGAATGAAGG + Intronic
1180389070 22:12208397-12208419 GAACATCTTAAAATGATTGAGGG - Intergenic
1180659504 22:17453758-17453780 TGAAAACTTTAAATGAGTGAAGG + Intronic
1182901914 22:33905547-33905569 TGGATTTTTAAAATGAATGATGG - Intronic
1203243398 22_KI270733v1_random:39985-40007 TGACCTCATAAAATGAATTAGGG + Intergenic
949094239 3:66907-66929 TAATATAATAAAATGAATGATGG + Intergenic
949142237 3:648653-648675 TGAGTTCATACAAGGAATGAAGG - Intergenic
949714188 3:6909504-6909526 TGAGATCTTAATCTGAGTCAAGG - Intronic
950047157 3:9955589-9955611 TGAGGACTTAAAAAGAATAATGG - Intergenic
951905166 3:27699090-27699112 AGAAATGTTAAAATGAAAGAAGG + Intergenic
952184300 3:30952359-30952381 TGAGAGATAAAAATAAATGATGG - Intergenic
953466403 3:43124491-43124513 TGACTTCTTAAAATAAATAATGG + Intergenic
953688416 3:45096319-45096341 GGAGCTGTTAAAAAGAATGAGGG + Intronic
953836285 3:46348269-46348291 TGTCTTCTTAGAATGAATGAGGG + Intergenic
954593344 3:51803072-51803094 TTAAATCTTAAAAGGAATCAAGG + Intergenic
955295277 3:57729243-57729265 TGACTTTTTAAAATGCATGATGG - Intergenic
955383882 3:58463175-58463197 TGGGACCTAAGAATGAATGAAGG + Intergenic
955573797 3:60336496-60336518 TGAGATCTTGAAATTTATAAGGG - Intronic
955621983 3:60874387-60874409 AGAGCTCTTGAAATTAATGAAGG - Intronic
957575994 3:82009111-82009133 TGCGTTCTTAAAATAAATGGGGG + Intergenic
957589161 3:82172968-82172990 TGGCATCATAAAATGAATTAGGG + Intergenic
957677194 3:83383784-83383806 TGAGAATTTAAAATGAATATAGG - Intergenic
957812960 3:85252046-85252068 TGAGATCTTATGATGTTTGATGG - Intronic
958819756 3:98959725-98959747 TGAGATAATACAGTGAATGATGG + Intergenic
959795074 3:110417035-110417057 TGTGTTCATAAAATGAATGCTGG + Intergenic
961985721 3:131131228-131131250 TGACATCTTAAAATGAGTTAGGG + Intronic
962772839 3:138629233-138629255 AGAGATCTTATAATGAATCAAGG + Intronic
963283407 3:143409392-143409414 TGAGAGTCTAGAATGAATGATGG + Intronic
963402900 3:144824084-144824106 TGAGATTTTCAAATTAAAGATGG - Intergenic
963844124 3:150137782-150137804 GGAGATCTTAAATTTTATGATGG - Intergenic
964068063 3:152600674-152600696 TGAGATCTAAAACAGAATAATGG - Intergenic
964857433 3:161162021-161162043 TGAATTATTAAAAAGAATGAAGG + Intronic
965343181 3:167515117-167515139 TGAGCTCATAAAATGAGTGAGGG - Intronic
965675598 3:171192370-171192392 TGAGATCATACAATGCATGGAGG + Intronic
969930085 4:10622413-10622435 TGAGAGCTTACAATTCATGACGG + Intronic
971496390 4:27270375-27270397 TGTGATCTTAAAATATTTGAGGG - Intergenic
971984437 4:33803286-33803308 TGAGAGCTGAAAATAAATAATGG + Intergenic
972735532 4:41837440-41837462 TCAGATTTTAAAATAAATGTTGG - Intergenic
972792128 4:42383147-42383169 TGTAATGTGAAAATGAATGATGG + Intergenic
973948599 4:55987189-55987211 TGAGATTTTCAAATGACTGATGG + Intronic
974178156 4:58351204-58351226 TGATATTTGAAAATGAATGACGG + Intergenic
975625761 4:76345319-76345341 TGAGTTCTCATAATCAATGAGGG - Intronic
977186409 4:93943400-93943422 TGGGTTATTAAAATGAACGATGG - Intergenic
977736902 4:100427658-100427680 TGAAATCTCCAAATAAATGAGGG - Intronic
978570408 4:110130818-110130840 TGATATCCTAAAATGACTGATGG - Intronic
979185441 4:117785462-117785484 TGAGTTCTTATAATAATTGAGGG - Intergenic
980188927 4:129497685-129497707 TGAGATCTTAAACTGGTTGAGGG + Intergenic
980508417 4:133754390-133754412 TTAGACTTTAAAATGAATGCAGG - Intergenic
980564825 4:134526079-134526101 TGAGATCTAAAGTTGCATGATGG + Intergenic
980717199 4:136641585-136641607 TTAGATCATAAAAAGAATGTAGG + Intergenic
981442650 4:144800113-144800135 TGAGTTCTTAAAGTGTAAGAGGG - Intergenic
981723898 4:147828139-147828161 TGAAATCCTAAATTGAATAATGG + Intronic
981778389 4:148396688-148396710 TGTGATTTTTAAATGAATTAAGG - Intronic
981795933 4:148595472-148595494 TGAGCTCATAAAATGAGTTAGGG + Intergenic
982119311 4:152125830-152125852 TGGGTTCATAGAATGAATGAGGG + Intergenic
982518850 4:156387428-156387450 CATAATCTTAAAATGAATGATGG - Intergenic
982733931 4:158985268-158985290 TGACCTCATAAAATGAGTGAGGG - Intronic
983093121 4:163529492-163529514 TTACATTTTAAAATAAATGAGGG - Intronic
983297057 4:165879557-165879579 TAATATTCTAAAATGAATGATGG - Intronic
985074398 4:186198738-186198760 TGGGCTCTTTAAAGGAATGAAGG - Intronic
987247075 5:16059890-16059912 TCACATCTTGAAATGAAGGAAGG + Intergenic
987258710 5:16182114-16182136 TGCCAACTGAAAATGAATGAGGG + Intergenic
987663900 5:20910712-20910734 TGAGATTTTAAAATGCATATGGG + Intergenic
988392027 5:30646607-30646629 TGAGATCTTTAAAACATTGATGG + Intergenic
988758788 5:34291479-34291501 TGAGATTTTAAAATGCATATGGG - Intergenic
988912086 5:35853475-35853497 TGAGATCCTAAAATGTTAGAGGG - Intronic
988994407 5:36700981-36701003 TGAGATCATTAAATGGCTGAAGG + Intergenic
989951292 5:50300637-50300659 GAAGATTTTAATATGAATGAAGG - Intergenic
990430677 5:55732518-55732540 TGAGAGCTTAAAGTAAGTGAAGG - Intronic
990599232 5:57340583-57340605 TTAGATCTTAAAAGTAATGCAGG + Intergenic
991490841 5:67181308-67181330 TGAAATCTCAAGATGAAGGAAGG + Intergenic
992353872 5:75958987-75959009 TGAGGTCTTAAAATATTTGAGGG - Intergenic
992819823 5:80485209-80485231 TGACATCTAAACATGAATAAAGG - Intergenic
992987565 5:82248878-82248900 GAATATATTAAAATGAATGATGG - Intronic
993753095 5:91694104-91694126 TAAGATTTCAAGATGAATGATGG + Intergenic
993845716 5:92940747-92940769 TTAGATCTCACAATTAATGAAGG - Intergenic
993984982 5:94586677-94586699 TGACCTCATAAAATGAATTAGGG - Intronic
995368524 5:111391239-111391261 AGAGATCTCAGAAAGAATGAGGG + Intronic
995529487 5:113078290-113078312 TGGCCTCATAAAATGAATGAGGG - Intronic
996053885 5:118963867-118963889 GGGGGTATTAAAATGAATGAAGG - Intronic
996294268 5:121893257-121893279 TGCGATCATAAAATGAGTTAGGG - Intergenic
996536113 5:124580115-124580137 TAAGATCTGGAAATCAATGAAGG + Intergenic
996581372 5:125035609-125035631 TCAGATCTTAAAATGATTAGGGG + Intergenic
996693250 5:126364361-126364383 TGAAATATTATAATTAATGATGG + Intronic
996983291 5:129526958-129526980 TGCGATATAAAAATGAATGTTGG + Intronic
997833379 5:137172287-137172309 TGAGGTATCAAAATGAATGGAGG - Intronic
1002831557 6:826470-826492 TGACCTCATAAAATGAATTAGGG + Intergenic
1004129335 6:12904037-12904059 CTAAATCTTAAAATGAATGCAGG - Intronic
1004285249 6:14315480-14315502 TGAGATCTAAGAAAGAAGGAAGG + Intergenic
1004435281 6:15586626-15586648 TTAAATATTTAAATGAATGAGGG - Intronic
1005030244 6:21501558-21501580 TGAGTTTTTAAAGTGAATGCAGG + Intergenic
1005958235 6:30679378-30679400 GGAGATCTTAAGCTGAAGGAGGG + Exonic
1007497662 6:42271975-42271997 TGCGTTTTTAAAATGGATGACGG + Intronic
1007915319 6:45556249-45556271 GGAAATCTTAAAATGAAAGCAGG + Intronic
1008021481 6:46583137-46583159 TGAGAAGTTAAAATGAAGCATGG - Intronic
1008780058 6:55092661-55092683 TGTCCTCATAAAATGAATGAGGG - Intergenic
1009318860 6:62259455-62259477 TGAAATTATAAATTGAATGATGG - Intronic
1009586011 6:65603351-65603373 TGAGATTTAGAAGTGAATGATGG + Intronic
1010371446 6:75114192-75114214 TGAGATCATAAAATGGCTTAAGG + Intronic
1010505485 6:76652910-76652932 TAATATCATAAAATGAAGGATGG - Intergenic
1010650892 6:78454752-78454774 TGAGTTCTTACAATATATGATGG - Intergenic
1010880421 6:81162111-81162133 TGAGTTTTTAAAGTGAATGAAGG - Intergenic
1012208390 6:96489979-96490001 TCAGATATTAAAATGAATTAAGG + Intergenic
1012554662 6:100497086-100497108 TGAGATGTTAAAATGAAAAAAGG - Intergenic
1012624626 6:101391946-101391968 TGGGATCTTCAAATGACTAATGG + Intergenic
1013387717 6:109648726-109648748 TGACCTCATAAAATGAATTAGGG - Intronic
1015080243 6:129215551-129215573 TGATATCATAGAATGAATGATGG + Intronic
1015579892 6:134712909-134712931 TACGATTTTAAAATGAATCAAGG - Intergenic
1015876038 6:137823684-137823706 TGACATCCCAAAATAAATGAAGG - Intergenic
1016610376 6:145982343-145982365 TAAGATATTAAAATGAATAATGG + Intergenic
1017119680 6:151012542-151012564 TGTGAGTTTAAAATGACTGAGGG - Intronic
1018546970 6:164948325-164948347 TGGCATCATAAAATGAATTAGGG + Intergenic
1018775628 6:167012694-167012716 TTAGATCTTAAAATGTATGTAGG - Intronic
1019946327 7:4332145-4332167 TTATATCTTAAAATGAGTGCTGG + Intergenic
1020754063 7:12179066-12179088 TGAGATAGTAAAAAAAATGAGGG + Intergenic
1021330140 7:19327054-19327076 AAAGATCTTAAACAGAATGAAGG + Intergenic
1022188556 7:27994648-27994670 TGAAATCTTAAAATGAAATTAGG + Intronic
1023735958 7:43236034-43236056 TGAGAAATTAAAATTAATGAAGG + Intronic
1024601374 7:50984604-50984626 TGTGAGCTATAAATGAATGATGG - Intergenic
1027976573 7:85164478-85164500 TGAGAACTTATAATGACTAAGGG - Intronic
1029013750 7:97292166-97292188 TTAGTTCTTAAACTGAATGGTGG + Intergenic
1030378346 7:108780808-108780830 TGAAATGATAAAATTAATGAGGG + Intergenic
1030713720 7:112785318-112785340 TTAGTTCTTAAAGTGAATGAAGG + Intronic
1031689701 7:124772522-124772544 TGAGATCTGCAAGTGAATGCAGG + Intergenic
1032134119 7:129259088-129259110 AGAGGTCTTAATGTGAATGAAGG - Intronic
1033666451 7:143445331-143445353 AGAGATTTTAAAGTGAATGGAGG - Intergenic
1034373264 7:150620050-150620072 TTAGATCTTCAAATGAGTCAGGG - Intergenic
1034839549 7:154383025-154383047 TGAGATTTTAAAAGGAATATTGG - Intronic
1035132229 7:156666166-156666188 TGAGATCCTAAAACATATGAGGG - Intronic
1035792051 8:2315843-2315865 TGAAATATTAAAATGACTTAAGG + Intergenic
1035800754 8:2405862-2405884 TGAAATATTAAAATGACTTAAGG - Intergenic
1035841279 8:2813990-2814012 GGAGATGTTAATATGAAGGAAGG - Intergenic
1036430466 8:8685179-8685201 TGAGATCTGATAATGGATCAAGG - Intergenic
1036738815 8:11343374-11343396 TGAGATCTTGAAATGAAGCATGG + Intergenic
1038087487 8:24216174-24216196 TCACATTCTAAAATGAATGAAGG + Intergenic
1040365547 8:46711332-46711354 GAAGACCTTAAAAGGAATGATGG + Intergenic
1041532075 8:58880312-58880334 TGAGTTCCTAAAATGTAAGATGG + Intronic
1041823026 8:62061601-62061623 TGAAATTTTACAATTAATGATGG + Intergenic
1043147870 8:76679012-76679034 GGAGATTTTAAAAAGACTGAGGG - Intergenic
1043149303 8:76693770-76693792 TTAGTTCTTGAAATGAAGGAGGG + Intronic
1043292723 8:78623314-78623336 TGAGATGTAAAAAGGCATGATGG - Intergenic
1044127644 8:88477831-88477853 TGACATCATAAAATGAGTTAGGG - Intergenic
1044272192 8:90259285-90259307 TGAGTTTTTAACATGAAGGAAGG - Intergenic
1044285472 8:90407504-90407526 TCAAAACTTAAGATGAATGATGG + Intergenic
1045561195 8:103265264-103265286 TCACATATTAAAATGAATGTAGG + Intergenic
1046185412 8:110708554-110708576 TGAGATTTCAGAAAGAATGAGGG - Intergenic
1047377252 8:124312227-124312249 TGAGATCTTAAATAGAATTTCGG - Exonic
1048710588 8:137206028-137206050 TTAGATCTCAAAAAGAATGCCGG - Intergenic
1048733135 8:137466397-137466419 TTAGAGCTTAAAATGTATGAAGG + Intergenic
1048823529 8:138400930-138400952 AGAGATCTTAAAATGGTTGATGG - Intronic
1050165099 9:2757272-2757294 GGAGAACTTAAAAGGAAAGAGGG + Intronic
1050490503 9:6183333-6183355 TGACTTCATAAAATAAATGAAGG - Intergenic
1050626835 9:7513037-7513059 TGAGTTCTGAAATTGTATGATGG + Intergenic
1050656265 9:7832040-7832062 TGACATGTGAAAATGAATCATGG - Intronic
1051458114 9:17284268-17284290 TGACCTCATAAAATGAATTAGGG + Intronic
1051995515 9:23211598-23211620 TGAGATCTTAAAATGAAAAGAGG - Intergenic
1053543391 9:38997926-38997948 TGTGAGCTGAAAAAGAATGAAGG - Intergenic
1053807823 9:41821435-41821457 TGTGAGCTGAAAAAGAATGAAGG - Intergenic
1054622769 9:67365993-67366015 TGTGAGCTGAAAAAGAATGAAGG + Intergenic
1054949134 9:70830229-70830251 TGAAATTTTCAAATGAATAAAGG + Intronic
1055080366 9:72262641-72262663 TCACAACTTGAAATGAATGATGG + Intergenic
1056915349 9:90741279-90741301 AGAGTTCTTAAAGTGAAGGAGGG + Intergenic
1059301048 9:113313864-113313886 TAAGATCTAAGAATGGATGAAGG + Exonic
1060432037 9:123558743-123558765 TGGCATCTTGAGATGAATGAAGG - Intronic
1203459721 Un_GL000220v1:23067-23089 TGACCTCATAAAATGAATTAGGG + Intergenic
1185687789 X:1944068-1944090 TATGATCTCAAAAAGAATGATGG + Intergenic
1186380764 X:9056282-9056304 AGAGCTCCTAAAATAAATGAAGG + Intronic
1186716985 X:12262797-12262819 TGAGATTGTATAAGGAATGAAGG + Intronic
1187076364 X:15939188-15939210 TGAGATACTAAGAAGAATGAGGG + Intergenic
1187469728 X:19558509-19558531 TGATATTTTAAAATGGATGATGG - Intronic
1187490276 X:19744802-19744824 TGAGAACTTTAAATCAACGAAGG - Intronic
1188191004 X:27171769-27171791 TGAGATCTTATAAGGGATTATGG + Intergenic
1188382477 X:29512967-29512989 TGAGAACATAAAATAAATAATGG + Intronic
1188414782 X:29919244-29919266 TGAAATGCTAAAATAAATGAAGG + Intronic
1190499893 X:51064074-51064096 TGGAATCATAAAATGAATTAGGG - Intergenic
1190768684 X:53497282-53497304 AGAGATCTTAACATTAATGCTGG - Intergenic
1191153586 X:57246360-57246382 TGACCTCTTAAAATGAGTTAAGG - Intergenic
1193239305 X:79147873-79147895 TGAGATCTGAAAATTAAAGTGGG + Intergenic
1193919281 X:87406153-87406175 TGAGAACTTAAAATGGTTGAAGG + Intergenic
1195140443 X:101953829-101953851 TGACCTCTTAAAATGAGTTAGGG - Intergenic
1195305711 X:103581376-103581398 TGACCTCTTAATATGAATTAAGG - Intronic
1196123697 X:112077728-112077750 TCAGATCCTAAAATAAATTAGGG + Intronic
1196245590 X:113395405-113395427 TGATTTTTTAAAATGAAGGATGG - Intergenic
1197035279 X:121866582-121866604 TGAGCCCTTAAAGTCAATGAAGG + Intergenic
1197267930 X:124396183-124396205 TAAGAGCTAAAAAAGAATGAAGG + Intronic
1197413533 X:126147441-126147463 TGAGCTCATAAAATGAGTTAGGG + Intergenic
1197625198 X:128794196-128794218 TGACCTCTTAAAATGAGTTAGGG - Intergenic
1197687014 X:129451555-129451577 TGACAGGTTAAAAGGAATGAAGG - Intronic
1198769994 X:140120140-140120162 GGAAATAGTAAAATGAATGAAGG + Intergenic
1199295780 X:146156998-146157020 TCAGATAATAAAATGAATGATGG + Intergenic
1199479959 X:148287637-148287659 TCAGATGTTAAATTAAATGATGG - Intergenic
1200341302 X:155399477-155399499 TGTGAACTGAAAATGACTGAAGG - Intergenic
1201239440 Y:11944445-11944467 AGAGATCTTAACATGAAGGGAGG + Intergenic