ID: 933024937

View in Genome Browser
Species Human (GRCh38)
Location 2:77244582-77244604
Sequence AAGTATCAGGAGGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933024937_933024946 13 Left 933024937 2:77244582-77244604 CCCTCCACCCCCTCCTGATACTT 0: 1
1: 0
2: 0
3: 27
4: 339
Right 933024946 2:77244618-77244640 ATCACCTCCCCCATGAGTGTAGG 0: 1
1: 0
2: 0
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933024937 Original CRISPR AAGTATCAGGAGGGGGTGGA GGG (reversed) Intronic
900360236 1:2284739-2284761 AAGAGTCAGGGAGGGGTGGATGG + Intronic
902353620 1:15879190-15879212 AATTATCTGGAGGTGGTGGTGGG + Intronic
902730819 1:18367753-18367775 AATTAGCAGGATGTGGTGGAAGG - Intronic
903098325 1:21002469-21002491 AAGTATTAAAAGGGAGTGGAGGG + Intronic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904341329 1:29836890-29836912 AAGGAGCTGGAGGGGCTGGAGGG - Intergenic
904485707 1:30823515-30823537 AAGGATCAGGGGTGGTTGGAAGG - Intergenic
904557323 1:31373580-31373602 AAGAAATAGGAGGGGGTGAATGG + Intronic
906561474 1:46761150-46761172 CAGTATCAAGGGAGGGTGGAGGG + Intronic
907318172 1:53585866-53585888 AAGTTTCTGTAGGGGGTGGAGGG - Intronic
907553800 1:55327244-55327266 AAGTATCAGGTGGAGAAGGAGGG + Intergenic
907720526 1:56967855-56967877 AAGTATAGTGAGGGGATGGATGG + Intergenic
907808505 1:57844880-57844902 AAGGAGCTGGCGGGGGTGGAGGG - Intronic
907885527 1:58589221-58589243 AAGTAGCAGGAGGTGGCTGATGG - Intergenic
908438839 1:64133164-64133186 AAGGAGAACGAGGGGGTGGAGGG + Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
909246608 1:73293341-73293363 TAGCATCTGGAGGGGGTAGATGG - Intergenic
909617231 1:77624730-77624752 AAATCTGAGGAGGGGGTGGTGGG + Intronic
909800662 1:79803665-79803687 AAATAGCAGGAGGAGGTGAAAGG - Intergenic
910172311 1:84390662-84390684 AAGTTACAGGATGAGGTGGAGGG + Intergenic
910354585 1:86340780-86340802 AAGCCTCAGGAGAGGGTGGTGGG - Intergenic
910649129 1:89545838-89545860 AAGTTGAAGAAGGGGGTGGACGG + Intronic
911680263 1:100707327-100707349 AAGTCACAGGATGAGGTGGAGGG - Intergenic
912469829 1:109898980-109899002 AATGATCAGGAGGTGGTGGGTGG + Intergenic
913223385 1:116677509-116677531 AAAGATCAAGAGGGGTTGGAAGG - Intergenic
915515307 1:156409304-156409326 ATGTATGAGCAGGGGATGGAAGG + Intronic
919132116 1:193464618-193464640 CAGTACCAGAAGGGGGTGGGAGG - Intergenic
919241048 1:194916767-194916789 AAGTATCAGGGATGGATGGAAGG - Intergenic
921878786 1:220230078-220230100 AAGAATGAGGAGGGGAGGGAAGG - Intronic
921945406 1:220882766-220882788 AAGCAGCAGGAGGAGGAGGAAGG - Intronic
924936461 1:248776166-248776188 AAGTCAGAGGAGGGGGCGGATGG + Intergenic
1063518822 10:6722527-6722549 AAGATTCAGGAGGGAGAGGAAGG + Intergenic
1064097512 10:12434915-12434937 AGGAATCAGGAGGGGAGGGAAGG + Intronic
1064604357 10:17023188-17023210 AAGTACTGGGTGGGGGTGGAGGG + Intronic
1065966968 10:30778662-30778684 AAGAATGAGGAGTGGGAGGATGG + Intergenic
1067092532 10:43275764-43275786 AAGGACTGGGAGGGGGTGGAAGG - Intergenic
1067140235 10:43650170-43650192 AAGTCTGAGAAAGGGGTGGAGGG + Intergenic
1068602845 10:58973912-58973934 TAGAATCAGGAAGGGGTGGTGGG + Intergenic
1069785877 10:70987649-70987671 AAGTATCTGGAGCGTGAGGAGGG + Intergenic
1071774749 10:88773490-88773512 AAATAACAGGACAGGGTGGAAGG + Intronic
1072417989 10:95264778-95264800 AAGTCTAGGGTGGGGGTGGAGGG - Intronic
1076656118 10:132024787-132024809 AAGAAATAGGAGGGGGTGGGTGG - Intergenic
1077308048 11:1876621-1876643 AAGTGTCTGCAGGGGGAGGACGG + Intronic
1079196453 11:18331763-18331785 AAGTATTAGGAAGGGGAGTACGG - Intronic
1079642831 11:22828643-22828665 TAGTATGAGGATGGGGGGGAGGG + Intronic
1079742951 11:24086521-24086543 CAGTATCTGGAGGGGGAGGAGGG - Intergenic
1081930555 11:46867982-46868004 ACGTCTCTGGAGGAGGTGGAAGG - Exonic
1082752807 11:57038807-57038829 AAGACTCAGCAGGGGGTAGAGGG + Intergenic
1083891196 11:65596545-65596567 AAGGATCAGGTGGGGGTGGGAGG + Intronic
1084576686 11:69993136-69993158 CTGTCTCAGGAGGGGGTGGCTGG - Intergenic
1084741701 11:71144186-71144208 AAGGCTCAGGAGGTGGGGGAGGG + Intronic
1084978845 11:72817811-72817833 AAGTGGCAGGAGGAGGAGGAGGG + Exonic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085471728 11:76762898-76762920 GAGTGTTAGCAGGGGGTGGATGG - Intergenic
1085510854 11:77087429-77087451 AAGGAGCTGGAGGGGATGGACGG - Intronic
1085770579 11:79322077-79322099 ATGTAGCAGGAGGTGGTGCAGGG - Intronic
1085816797 11:79745981-79746003 ACGTATCAGGAAGCAGTGGATGG - Intergenic
1086337186 11:85811329-85811351 AAGCAGCAGGCGGGGGCGGAGGG - Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087342602 11:96927205-96927227 AATTAGCAGGGTGGGGTGGATGG - Intergenic
1087508792 11:99062806-99062828 ATGTATCAAGAGTGGGAGGAGGG - Intronic
1088396276 11:109373477-109373499 AAGGATCAGGTGTGGATGGATGG + Intergenic
1088651736 11:111963319-111963341 AACGATCAGGAGGAGGTGGGAGG - Intronic
1089503341 11:118946162-118946184 GAAAATCAGGAGGGAGTGGATGG - Intronic
1089637956 11:119828475-119828497 AGGCATCAGGAGAGGGTGGCTGG + Intergenic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1089879731 11:121762300-121762322 AAAAATCAGGAGGGGATGGGAGG + Intergenic
1090347364 11:126082394-126082416 AAGGAACAGCAGGGGGTGCAGGG + Intergenic
1090502966 11:127279720-127279742 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1090855581 11:130607319-130607341 AAGGCTGAGGAGGAGGTGGAGGG + Intergenic
1091718874 12:2797937-2797959 AAGAAGCAGGAAGGGCTGGAGGG - Intronic
1092991768 12:13909823-13909845 AAGTATCAGGAAAGAGAGGAGGG + Intronic
1093419180 12:18955018-18955040 AAGTATCAGGAGGGACAGAAAGG - Intergenic
1094423669 12:30297629-30297651 AATTAGCAGGATGGGGTGTACGG - Intergenic
1095311727 12:40706257-40706279 AAGCATCAGGGGAGGGGGGAGGG - Intronic
1095853238 12:46832367-46832389 AAGTATCAGAAAGGGATGGATGG + Intronic
1095854409 12:46844447-46844469 TAGCATCAGGAGAGGCTGGAGGG + Intergenic
1096389765 12:51218892-51218914 AAATATCGGGAGAGGGTGGGAGG - Intergenic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1097196071 12:57243082-57243104 AGGGATGGGGAGGGGGTGGAGGG - Intergenic
1097770448 12:63578312-63578334 AAGGATAGTGAGGGGGTGGAGGG + Intronic
1098545522 12:71707242-71707264 AATAATGAGGAGGGGGTGGAAGG - Intergenic
1099800829 12:87454470-87454492 AAGTATCAGGAGTGGCTGAAAGG + Intergenic
1099964266 12:89428703-89428725 AAGTAGCTGGAGGTGGTGGTGGG - Intronic
1100839350 12:98596433-98596455 AAATATTAGGAGGGAGAGGAAGG + Intronic
1102219336 12:111183808-111183830 AAATATCTGCAGGGGGTGGTGGG - Intronic
1102460216 12:113095245-113095267 AAGCATCTGGAGGAGTTGGAGGG - Intronic
1102496087 12:113320527-113320549 AAGCAGCAGGAGAGGGTGCAGGG - Intronic
1102719740 12:115005778-115005800 AAAAATCAGGATTGGGTGGAAGG - Intergenic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103844209 12:123890145-123890167 AGGGATCAGGACGAGGTGGAGGG + Intronic
1103997824 12:124841604-124841626 AAGTGACTGGAGGGGGTGAAAGG - Intronic
1105918714 13:24941122-24941144 AAGTAGGAGGAGAGGTTGGAAGG + Intergenic
1105974750 13:25463836-25463858 CAGAAGCATGAGGGGGTGGAAGG - Intronic
1108514674 13:51189245-51189267 AAGTATCTGGAAGGGGTTCAGGG - Intergenic
1110702726 13:78567967-78567989 AAGAATCAAGAAGGGGTGGGGGG + Intergenic
1111890984 13:94082307-94082329 AACTATGAAGAGGTGGTGGAAGG - Intronic
1111980961 13:95014553-95014575 AAGAAGCAGGATTGGGTGGATGG - Intergenic
1111990908 13:95116263-95116285 CAGTATCAGGAAGGGTTGGTGGG + Intronic
1112844440 13:103621815-103621837 TGGTAGCAGGAGGTGGTGGATGG - Intergenic
1114529760 14:23388407-23388429 AGATATAGGGAGGGGGTGGAAGG - Intronic
1114759790 14:25300794-25300816 AACTATCAGGAGAGGGTAGCTGG - Intergenic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1118320419 14:64749289-64749311 AAGTAGCAGGTGGGGCTGGCGGG - Exonic
1118335051 14:64846279-64846301 AAACATCAGGAGGGGTAGGAGGG + Intronic
1118860635 14:69660350-69660372 AAGTGTCAGAATAGGGTGGAAGG - Intronic
1119034532 14:71218435-71218457 AAGGGCCAGGAGGGGGTGGAGGG - Intergenic
1119226748 14:72950264-72950286 AGGTATCAGGAGTGGAGGGAAGG + Intronic
1119597192 14:75945841-75945863 AAGCAGCTGGAGGGAGTGGAAGG + Intronic
1119651704 14:76388547-76388569 AAGTTTAAGGTGGTGGTGGAGGG + Intronic
1120335730 14:83151754-83151776 AGGGAAGAGGAGGGGGTGGAAGG + Intergenic
1121241328 14:92432053-92432075 ATGTACCAGGAAGGTGTGGATGG + Intronic
1122410086 14:101521400-101521422 TAGAATCAGGAGGTGGGGGAGGG + Intergenic
1122970334 14:105149834-105149856 AAGTAAGGGGAGGGGGTGGTAGG + Intronic
1123392896 15:19895234-19895256 AAGGAGGAGGAGGGGGAGGAAGG - Intergenic
1124041546 15:26110198-26110220 AAGAAGGAGGAGAGGGTGGAGGG + Intergenic
1124201198 15:27679780-27679802 AAGAGTCAGGAAGGGGTGGGGGG + Intergenic
1124866143 15:33493213-33493235 AAGCATCGGCAGGGGGAGGAAGG - Intronic
1126339841 15:47627178-47627200 AAGTAGGAGGAGTGGGAGGAAGG + Intronic
1126970177 15:54101882-54101904 AAGTATAAGAATGGGGAGGATGG - Intronic
1128877198 15:71212047-71212069 GAGGATCAGGAAGGAGTGGAGGG + Intronic
1130677839 15:85969453-85969475 ATGTGTGAGGAAGGGGTGGATGG - Intergenic
1131648715 15:94375434-94375456 AATTATCAGGAGGCAATGGAGGG + Intronic
1131971089 15:97893692-97893714 AACTATCAGGAGTGGAAGGAAGG + Intergenic
1132479351 16:159390-159412 AAGTTTCAGGAGTGAGTGGGGGG + Intronic
1132490933 16:230506-230528 AATTAGCCGGAGGGGGTGGCGGG - Intergenic
1132621228 16:869133-869155 AAGCCTCAGGAGGGAGTGGAGGG - Intronic
1133025459 16:2987274-2987296 AGGTACCAGGAGGGGCTGGCTGG + Intergenic
1133317897 16:4895364-4895386 AAGTATGAGGACGTGGTGCAGGG - Exonic
1135229192 16:20689706-20689728 AAGTAAAAGGAGGAGGTGAATGG - Intronic
1135842186 16:25886994-25887016 AAGTTTTTGGAGTGGGTGGAAGG + Intronic
1137268991 16:46890404-46890426 AAGAATAAGAAGGGGGTGCAGGG - Intronic
1137659772 16:50194673-50194695 AAGGAGCGGGTGGGGGTGGAGGG - Intronic
1138299674 16:55915539-55915561 AAATAGCAGGTGGGGTTGGAGGG + Intronic
1138613814 16:58148456-58148478 AAGTGTCGGTAGGGTGTGGAGGG - Intergenic
1140292610 16:73675089-73675111 AAGTATAAGGAGGAGGTGTTGGG - Intergenic
1141167384 16:81669540-81669562 AAGTATGAAGTGGGTGTGGAAGG - Intronic
1142352246 16:89585817-89585839 GAGGGTCAGGTGGGGGTGGAGGG + Intronic
1143301047 17:5910887-5910909 AAGGATGAGGAGGAGGTAGAGGG + Intronic
1143476505 17:7206454-7206476 CAGGAGCAGAAGGGGGTGGAGGG - Intronic
1143646654 17:8234728-8234750 AAGTATGAGGATGTGGGGGAAGG - Exonic
1144219149 17:13084176-13084198 AAGTCACAAGAGGGGTTGGAAGG + Intergenic
1144350833 17:14394513-14394535 AAGTATCACGGGTGGGTGAATGG + Intergenic
1144462266 17:15467676-15467698 AAGATTCAGGAGGGGGTGCATGG - Intronic
1145071776 17:19815984-19816006 AAGTATTAGCTGGGTGTGGAAGG - Intronic
1145863568 17:28226670-28226692 AAGGATCTGGTGCGGGTGGAAGG + Intergenic
1147445229 17:40471283-40471305 AAGAATGAGGAGGGGGTAGGAGG - Intergenic
1149765936 17:59278345-59278367 AATTATCAGGATGTGGTGGTGGG + Intergenic
1151496624 17:74461940-74461962 ATGGATCAGGATGGGGTGGGAGG - Intergenic
1152266277 17:79296837-79296859 AAGCAGGAGGAGGGGGAGGAGGG - Intronic
1152689241 17:81710451-81710473 AAGAATCAAGAGGCGATGGATGG - Intergenic
1153539400 18:6137892-6137914 AAGTCTCAGGACAGGGTGGTGGG + Intronic
1153779076 18:8478498-8478520 AAGGACCAGGATGGGGTGGGTGG + Intergenic
1155734189 18:29200856-29200878 GAGAAGCAGGAGGGGGTGAATGG + Intergenic
1158288889 18:55916848-55916870 AAGTATCAGGAAGAGGTTGCAGG + Intergenic
1161076334 19:2287579-2287601 AAGTTTCAGAAGGAGCTGGAAGG - Intronic
1161381658 19:3968664-3968686 AAGCATGAGAAGGGGGAGGAGGG + Intronic
1161446538 19:4322141-4322163 AAGTATCTGGAGGGGATAGCTGG + Intronic
1161446587 19:4322335-4322357 AAGTATCTGGAGGGGATAGCTGG + Intronic
1161509641 19:4663332-4663354 TAGAATGAGGATGGGGTGGATGG - Intronic
1162367205 19:10256824-10256846 AGGTAACAGGACAGGGTGGAGGG + Exonic
1162473629 19:10887148-10887170 AAGTGGCAGGAGGGGCTGCAGGG - Intronic
1162833925 19:13303817-13303839 AAGTCTCAGGGGGGCGTGCAGGG - Exonic
1164753489 19:30672790-30672812 AAGTACAAGGAGGGAGTGGGGGG + Intronic
1164940497 19:32249337-32249359 GAGTATCTGGGTGGGGTGGAGGG + Intergenic
1166643558 19:44514355-44514377 AAGGATCAGGAGGGTGAGGAAGG + Intronic
1166979598 19:46624763-46624785 AAGAAACAGGAGGTGGTGGGGGG - Intronic
1167033324 19:46978085-46978107 AAGTATAAGGGGAGGGTGGCAGG + Intronic
925306477 2:2850745-2850767 AAGTGGCAGGTGGGGGTGGCAGG - Intergenic
926104773 2:10143252-10143274 AAAGATCAGGAGCGGGTGGGTGG - Intronic
926268757 2:11348714-11348736 AAGCATCAGGAGGGCTAGGAAGG - Intergenic
927170886 2:20368373-20368395 AGGTAACAGGAGGGGATAGAAGG - Intergenic
928072185 2:28227914-28227936 AATAATCTGGAGGGGGTGGGAGG - Intronic
931483862 2:62670809-62670831 AATAATCAGGAGAGGGTGTATGG + Intergenic
931882818 2:66583770-66583792 AAGTAGCAGATGGGGGAGGAAGG + Intergenic
932103628 2:68923587-68923609 AAGTGTCCGGAGTGGCTGGAGGG - Intergenic
932993129 2:76812788-76812810 AAGGAGGAGGAGGGGGGGGAGGG - Intronic
933024937 2:77244582-77244604 AAGTATCAGGAGGGGGTGGAGGG - Intronic
933632240 2:84671642-84671664 AAGCAGCAGGAAGGGGTGGGGGG - Intronic
934685206 2:96316214-96316236 GTGGATGAGGAGGGGGTGGAGGG - Intergenic
935076347 2:99748239-99748261 AGGTATCTGGATGGGGTGGCAGG - Intronic
935784139 2:106533625-106533647 AAGGAACAGGGGAGGGTGGAAGG + Intergenic
937367358 2:121273324-121273346 AGGGATGAGGAGGGTGTGGAGGG - Intronic
938557062 2:132434832-132434854 AAACATCAGGTGGGGGTGAAGGG + Intronic
938935258 2:136121916-136121938 AGGTGCCAGGAGGAGGTGGATGG + Intergenic
939117970 2:138082827-138082849 AAGTAGCAGGAGAGGGTGTCTGG + Intergenic
939160638 2:138584508-138584530 AAGTGTCAGTTGGTGGTGGAGGG - Intergenic
939995663 2:148916911-148916933 AAAGATCAGGAGAGGGTAGATGG - Intronic
941350645 2:164429840-164429862 AAATAACTGCAGGGGGTGGACGG + Intergenic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
943147036 2:184058728-184058750 AAGTATCAGGAGGCTGTGTGTGG + Intergenic
943809880 2:192171716-192171738 AAGGATCAGGAGGGAATGAAGGG - Intronic
946668984 2:222082128-222082150 AACAATCAGGAGGATGTGGAGGG + Intergenic
947171087 2:227312273-227312295 AAGTTTCAGGAAGGGTTGGCGGG - Exonic
947900869 2:233720387-233720409 AATTATCAAGAGTGGGTGGAAGG + Intronic
947951997 2:234156205-234156227 AAGAAAGAGGAGGGGGAGGAGGG - Intergenic
948243163 2:236455500-236455522 GAGTATCAGGCTGGAGTGGAGGG + Intronic
948444013 2:238018094-238018116 AAGTCTCAGCAGGTGGTGGATGG - Intronic
1168787967 20:556298-556320 ACGTATATGGAGAGGGTGGAGGG + Intergenic
1168888355 20:1276087-1276109 AGGGAACAGGAGGGTGTGGAGGG - Intronic
1169192554 20:3667389-3667411 CAGAATCAGGAGCGAGTGGAAGG - Intergenic
1173142386 20:40495426-40495448 AAGTTTTTGGAGGGGGTGGGTGG + Intergenic
1173909782 20:46658046-46658068 AGGTATCAGGAGAGGGCTGATGG - Intronic
1174175469 20:48641910-48641932 AAGAAACAGGAGGGGAGGGAAGG + Intronic
1174226412 20:49004213-49004235 AAGTAGCTGGACGGGGTGGCAGG + Intronic
1174387661 20:50196997-50197019 AGAACTCAGGAGGGGGTGGAAGG - Intergenic
1174639341 20:52029783-52029805 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1175451420 20:59072082-59072104 TAGGATCTGGAGGGTGTGGAGGG - Intergenic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1179465293 21:41567793-41567815 AAGTGCCAGGAGGAAGTGGAAGG + Intergenic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1181906538 22:26201593-26201615 ACGTATCTGGAGGCGGTAGAAGG + Intronic
1181955822 22:26587264-26587286 CAGTATTAGGAGGGGGTGAAAGG - Intronic
1181963486 22:26640047-26640069 AAGCTGGAGGAGGGGGTGGAGGG - Intergenic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1183116010 22:35693354-35693376 CAGTATCACGGGCGGGTGGAGGG - Intergenic
1183922054 22:41177429-41177451 CAGTCTGAGGAGGGGTTGGAGGG - Exonic
1184026283 22:41859286-41859308 AGTTATCAGGAAGTGGTGGAAGG + Intronic
1184372130 22:44089378-44089400 CAGTGTCTGGAGGGTGTGGAGGG - Intronic
950312393 3:11969999-11970021 AGGTGTCAGAAGGAGGTGGATGG + Intergenic
950543275 3:13624856-13624878 CAGCACCAGGAGGGGGTAGATGG + Intronic
950610357 3:14123029-14123051 AAGGATCAGTGGGGGGCGGAGGG + Intronic
950936156 3:16841634-16841656 AAGTATCAGTGGGGGCTGGAAGG + Intronic
951393157 3:22131544-22131566 ATGTATCAGGAGAGAATGGAAGG + Intronic
951643563 3:24862968-24862990 AAGTACCAGGAGGACTTGGATGG + Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
952875931 3:37944475-37944497 AAGTAGCAGCTGGGGCTGGAAGG + Intronic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
957318266 3:78595533-78595555 AAGTATCAGGAGAGGATCAATGG + Intergenic
957981014 3:87510459-87510481 AGGTATCAGGAGGTGGTGAGTGG - Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
962481273 3:135800656-135800678 AGGTATCAGGAGAGTGTGCAAGG - Intergenic
962543227 3:136404494-136404516 AAGTATCATTAGGGGGAGTAGGG - Intronic
964984391 3:162721609-162721631 AAGAATAAGGAGGGGGTAGAAGG + Intergenic
965161785 3:165142031-165142053 AAGTATCTGTAGGTGGTGGCAGG + Intergenic
965803424 3:172517333-172517355 TACTTTCAGGAGGAGGTGGAAGG + Intronic
968658402 4:1788450-1788472 AAGCAGCAGGAGGTGGTGGTGGG - Intergenic
972033398 4:34491400-34491422 AACTATAAGGAGGTGGTTGATGG - Intergenic
974017086 4:56657175-56657197 AATTAGCAGGAGGAGGTGGATGG - Intronic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
976995819 4:91432113-91432135 AGGCAGCAAGAGGGGGTGGATGG - Intronic
977804925 4:101286017-101286039 ATGTACAAGGCGGGGGTGGATGG + Intronic
978177178 4:105746333-105746355 AAGGATGAGGAGGAAGTGGAGGG + Intronic
978818597 4:112937474-112937496 AATTATCTGGAGGTGGTGGCAGG - Intronic
980166950 4:129240761-129240783 ATGTATGAGGCGGGGGTGGGAGG - Intergenic
981790096 4:148526689-148526711 AAGTCCCAGGAGCGAGTGGAAGG - Intergenic
982777148 4:159453559-159453581 AAGAGGCAGGAAGGGGTGGAGGG - Intergenic
983087599 4:163466462-163466484 AATTAGCAGGATGTGGTGGAGGG + Intergenic
983720053 4:170839766-170839788 AAGAAACAAGAGTGGGTGGAGGG - Intergenic
986764703 5:10914276-10914298 AAGTATCATGATGGGGTGTGAGG - Intergenic
986800844 5:11258292-11258314 AAGCATTTGGAGGGGCTGGATGG + Intronic
987373907 5:17217445-17217467 ATGGAGCTGGAGGGGGTGGAGGG + Intronic
989092662 5:37750195-37750217 AAGTATCCGTAGGAGGTTGATGG - Intronic
989173775 5:38500069-38500091 AGGGATAAGGAGGGGGTGAAGGG - Intronic
989274411 5:39570340-39570362 AGATATCAGGAAGGGGTGGCGGG - Intergenic
990148255 5:52787706-52787728 AAGTGTCCGCAGGGGATGGAAGG + Intergenic
991929858 5:71743595-71743617 AAGCAACAGGAAGGGGTGGGGGG + Intergenic
992533112 5:77671402-77671424 CAGAATCTGGAGGGGGTGGAGGG + Intergenic
992628817 5:78660961-78660983 AAGTAAAAAGAGGGGGTGCAGGG + Intronic
993458960 5:88159685-88159707 AAGTATCTGGGCGGGGGGGAGGG - Intergenic
993717140 5:91286615-91286637 AAGTAACAGGAGTCGGTGCAGGG + Intergenic
994292272 5:98042004-98042026 AAGTATCAGGAGATGGAAGATGG + Intergenic
995591745 5:113706779-113706801 AAGTAGGAGGACGGGGTGCAGGG + Intergenic
997873944 5:137531696-137531718 TTGTATCAGGAGGTGGTGAAAGG + Intronic
998595906 5:143530232-143530254 AAGGATGAGGATAGGGTGGATGG - Intergenic
999886869 5:155934135-155934157 CAGTATCAGATGGGAGTGGATGG + Intronic
1000105504 5:158055248-158055270 AAGCATTAGGAGGGGGTGGGAGG + Intergenic
1000120636 5:158194662-158194684 ACGTAGCAGAAGGGGCTGGAGGG - Intergenic
1000401756 5:160836094-160836116 AAGAATGAGGAGGGGAGGGAGGG + Intronic
1002101745 5:176861330-176861352 CAGGTTCAGGATGGGGTGGATGG + Intronic
1005056942 6:21738290-21738312 AAGTATCAGTAGAGAGTGGTAGG + Intergenic
1005187065 6:23174510-23174532 ACGTAGCAGCAGGGGGTGGTGGG + Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1005886751 6:30102937-30102959 AAGCCTCTGTAGGGGGTGGATGG - Exonic
1006133477 6:31882407-31882429 AAGGGCGAGGAGGGGGTGGAGGG + Intronic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1007148826 6:39667268-39667290 AAGCCTCAGGATGGGGTGGGAGG + Intronic
1007709789 6:43815217-43815239 AGGCAGCAGGAGGAGGTGGATGG + Intergenic
1007770997 6:44192338-44192360 ACGTCTCTGGAGGGAGTGGATGG - Intergenic
1008545400 6:52578831-52578853 AAAAATTAGCAGGGGGTGGAGGG - Intergenic
1011194098 6:84764447-84764469 GAGCAGCAGGAGGAGGTGGAAGG - Exonic
1013167411 6:107606430-107606452 AAGTAACAGGTTGGGGTGGGTGG + Intronic
1013870443 6:114752220-114752242 AAGTATCTGAAAAGGGTGGATGG + Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1016310267 6:142726714-142726736 AAGAATGTGGAGGGGGTGGTGGG + Intergenic
1018027856 6:159819685-159819707 AAGGGTCAGGAGTGGGTGGCAGG + Intronic
1019707572 7:2503822-2503844 GAGGATCAGCTGGGGGTGGATGG - Intergenic
1020879524 7:13742082-13742104 AAATATCAGTGGGGTGTGGAAGG + Intergenic
1020901553 7:14009659-14009681 TAGTATCCTGAGGGGCTGGATGG - Intergenic
1021608478 7:22433284-22433306 CATTATGTGGAGGGGGTGGAAGG - Intronic
1021608512 7:22433463-22433485 CATTATGTGGAGGGGGTGGAAGG - Intronic
1022090367 7:27104026-27104048 AAGGATCAGGAAGGTGTGGGAGG - Intergenic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1022415209 7:30171548-30171570 TAGGAACTGGAGGGGGTGGATGG + Intergenic
1022647962 7:32249079-32249101 AGGTATCAGGAAGGAGTGGGTGG + Intronic
1022665913 7:32410376-32410398 GAGAAGGAGGAGGGGGTGGAGGG + Intergenic
1022929926 7:35100562-35100584 AAGGATAGTGAGGGGGTGGAGGG + Intergenic
1026218231 7:68368450-68368472 AGGTGGCAGGAGGGGGTGGGAGG - Intergenic
1026944228 7:74306048-74306070 AAGGATCTGGTGGGGCTGGAAGG - Intronic
1027882178 7:83854618-83854640 CAAAATCAGGAGGGGCTGGAAGG + Intergenic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1029825820 7:103193006-103193028 AAGGATAGTGAGGGGGTGGAGGG + Intergenic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1032787197 7:135210467-135210489 AAGGATCATGAGGAGGTGCATGG + Intronic
1033558258 7:142507863-142507885 GAGTCTCAGGTCGGGGTGGAGGG - Intergenic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1034449266 7:151128714-151128736 GAGTATGGGGAGGGGGTGGAGGG + Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035346558 7:158203675-158203697 AAGTATAGGGATGGGTTGGACGG - Intronic
1037671238 8:21016980-21017002 AGGTGTCAGGAGAGGGTTGACGG + Intergenic
1037819149 8:22127393-22127415 AAGTGCCAGGAGGGCCTGGAGGG - Exonic
1038284960 8:26198484-26198506 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1039213325 8:35239749-35239771 AGGTATCAGAAGGAGGAGGAAGG - Intronic
1040466563 8:47700991-47701013 AAGGCTCAGGAGGGAGAGGAGGG - Intronic
1042701568 8:71621140-71621162 AAATGTCTGGAGGGGGTGGGTGG - Intergenic
1045848096 8:106660624-106660646 ACGCATCAAGAAGGGGTGGAGGG + Intronic
1045848225 8:106661920-106661942 ATGCATCAAGAAGGGGTGGAGGG - Intronic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1047605295 8:126468458-126468480 AAGCTTCAGAAGGGGGTTGAGGG - Intergenic
1047742387 8:127817008-127817030 TTGTATCGGGAGGGGGTGGGGGG - Intergenic
1047973829 8:130110186-130110208 AAATTACAGAAGGGGGTGGAGGG + Intronic
1049101094 8:140579624-140579646 AAGTATCAGTAGGAAGTGGTGGG - Intronic
1049122057 8:140747735-140747757 AAGTAGGAGGAGGGGGAGGAAGG + Intronic
1049128764 8:140817238-140817260 AAGTATGGGCAGGGGGTGGGGGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1049883390 9:12926-12948 GAATATCAAGAGGGAGTGGAGGG - Intergenic
1049953971 9:674271-674293 AAGGATCAGCAGGGAGTGGATGG + Intronic
1050241250 9:3637999-3638021 AAGAAGGAGGAGGGGGAGGAAGG - Intergenic
1050874514 9:10617323-10617345 GAGTATCAGGAGGAAATGGAAGG - Intergenic
1051106583 9:13587667-13587689 ATGGAGCAGAAGGGGGTGGATGG - Intergenic
1052928127 9:34034960-34034982 AAGTTTCAGGAGTGCTTGGAAGG - Intronic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1054412365 9:64830513-64830535 AATTAGCAGGAGGTGGTGGCAGG - Intergenic
1056343767 9:85668349-85668371 AAGTATCAGGAGGGAGAGGTGGG + Intronic
1056860254 9:90174626-90174648 ACGTATCAGGGGTGTGTGGATGG + Intergenic
1056933878 9:90900776-90900798 ATGGAGCAGGAGGGGGTGGGAGG - Intergenic
1058694566 9:107548321-107548343 TAGTTTGAGGAAGGGGTGGAGGG + Intergenic
1059277380 9:113108003-113108025 GAGTATGGGGAGGGGGTGGCCGG - Intergenic
1059278871 9:113116548-113116570 GAGTATGGGGAGGGGGTGGCCGG + Intergenic
1061425357 9:130494914-130494936 AAGTCCCAGGAGCGAGTGGAAGG + Exonic
1186049270 X:5573056-5573078 TAGTATCAAGAGGCTGTGGAAGG - Intergenic
1186522943 X:10221791-10221813 AATTACCGGGAAGGGGTGGAAGG + Intronic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1187665668 X:21606840-21606862 ATGTATCATATGGGGGTGGAGGG - Exonic
1188026806 X:25218457-25218479 TGGTATCTGTAGGGGGTGGAGGG + Intergenic
1188494991 X:30774246-30774268 AAGATTCAGGAGGGTGGGGAAGG + Intergenic
1188984033 X:36753626-36753648 AAGAATCAGGAGGAAGTGCATGG - Intergenic
1189238185 X:39505094-39505116 AATTCTCAGCACGGGGTGGAGGG + Intergenic
1189304571 X:39977191-39977213 AAGGATCAGAAGGGGGTACAAGG + Intergenic
1192163210 X:68804106-68804128 AAGTATAAGAAGGGGGAAGATGG - Intergenic
1193093529 X:77521337-77521359 AAATGGCAGTAGGGGGTGGAGGG + Intronic
1193974077 X:88095996-88096018 AAGTACCAGAAGTGGTTGGAAGG + Intergenic
1195175483 X:102311349-102311371 AAGTTTCAGGAGGAAGTGAAAGG - Intronic
1195183381 X:102375744-102375766 AAGTTTCAGGAGGAAGTGAAAGG + Intronic
1195709551 X:107763204-107763226 AAGTTTAAGGGTGGGGTGGAAGG - Intronic
1195780682 X:108460391-108460413 AAGTATCTTTAGGGGGTGGAGGG - Intronic
1196434938 X:115665913-115665935 AAGTCCCAGGAGTGAGTGGAAGG + Intergenic
1197470547 X:126862620-126862642 AAGTATAATGAGGGGTTGGAGGG + Intergenic
1200002511 X:153069324-153069346 AAGTAGGAGGAGGAGGAGGAAGG + Intergenic
1200005213 X:153080686-153080708 AAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1200402425 X:156027222-156027244 GAATATCAAGAGGGTGTGGAGGG + Intergenic
1201234701 Y:11897862-11897884 AAGTCACAGGAGGAGATGGAAGG - Intergenic
1201237176 Y:11922732-11922754 AAGTCCCAGGAGTGAGTGGAAGG - Intergenic
1201300255 Y:12498775-12498797 AAGTAGGAGGAAGGGGGGGAAGG - Intergenic