ID: 933028519

View in Genome Browser
Species Human (GRCh38)
Location 2:77294586-77294608
Sequence GGCAGGAGAATGCACATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 354}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933028519 Original CRISPR GGCAGGAGAATGCACATTAA TGG Intronic
901422762 1:9162170-9162192 GGCAGGTGAATGCACACCTATGG - Intergenic
901521320 1:9787166-9787188 GGCAGGAGAATCCAGAAGAAGGG + Intronic
901637541 1:10677288-10677310 GGCAGGGGAAGGCACCTTCAGGG + Intronic
904335617 1:29795709-29795731 GGCATGGGAATGAATATTAAGGG + Intergenic
905712942 1:40122616-40122638 TGCAAGAGAAAGCACATTAAGGG - Intergenic
906242687 1:44251699-44251721 GGCATGAGCAAGCACAATAAAGG + Intronic
906373292 1:45272796-45272818 GGCTGGAGAATCCACTTTCAAGG + Intronic
906867789 1:49441250-49441272 GGCATGGGAATGGATATTAAGGG + Intronic
908419408 1:63945108-63945130 GGCCTGAGAATGCAAATTATGGG + Intronic
908737268 1:67289832-67289854 GGCATGGGAATGGATATTAAGGG + Intergenic
909051987 1:70777196-70777218 GGCAGGTTAATGCAAATTGAGGG - Intergenic
909172899 1:72317719-72317741 GGCATGGGAATGGATATTAAGGG - Intergenic
909549253 1:76879421-76879443 GGCATAAGAATGCATATTAAGGG - Intronic
909576609 1:77183596-77183618 GGCATGGGAATGGATATTAAGGG + Intronic
910561559 1:88597424-88597446 GGCATGGGAATGGATATTAAAGG + Intergenic
910587904 1:88899470-88899492 GGCATGGGAATGAATATTAAGGG + Intergenic
911199383 1:95029175-95029197 GGCAGGAGAATCCACTTCCAAGG + Intronic
911769587 1:101723379-101723401 GGCAAGAAAATGCATATTAGAGG + Intergenic
911982182 1:104581540-104581562 GGCATGGGAATGGATATTAAGGG - Intergenic
912252131 1:108022070-108022092 GGCATGGGAATGGATATTAAGGG - Intergenic
912733621 1:112131085-112131107 GGCATGGGAATGGATATTAAGGG - Intergenic
913154207 1:116078824-116078846 GGGAGGAGAAGGCAGATTACAGG - Intergenic
914355130 1:146878307-146878329 GGCTGGAGAATGCTAATCAATGG - Intergenic
916447363 1:164885698-164885720 CCCAGGAGAATGAACAATAAGGG - Intronic
917045144 1:170851372-170851394 GGCAGGAGAAAGAAAATAAAAGG + Intergenic
917764407 1:178201129-178201151 GGCATGGGAATGGATATTAAGGG + Intronic
918014562 1:180620567-180620589 GGCAGAAAAATGGACAGTAAAGG + Intergenic
918627363 1:186671721-186671743 GGTAGGAGAATGCAAGATAATGG + Intergenic
918814811 1:189168990-189169012 GGCATGGGAATGGATATTAACGG + Intergenic
918957969 1:191235765-191235787 GGCATAAGAATGAATATTAAGGG + Intergenic
919124947 1:193382405-193382427 GGCATGGGAATGGATATTAAGGG - Intergenic
919241509 1:194922243-194922265 GGCATGAGAATGGATATTAAAGG + Intergenic
920021745 1:202961638-202961660 GGAAGGAGAACACACATTAGAGG - Intergenic
920090905 1:203452510-203452532 GGCAGGAGAAGGCATATTTTAGG - Intergenic
920996049 1:210992825-210992847 GGTAGGAGAAGTCTCATTAAGGG - Intronic
923727100 1:236515910-236515932 GACAGGAGAATCCAAATTCAGGG - Intergenic
924847445 1:247787491-247787513 GGCAAGAGAATGGATATTAAGGG - Intergenic
1063204667 10:3819547-3819569 AGCAAGAGAATGAAGATTAATGG + Intergenic
1063621490 10:7653022-7653044 GGCAGGGAAATGCAAGTTAAAGG + Intronic
1063642486 10:7844247-7844269 GGAAGGAAAATGGACAATAATGG - Intronic
1064545947 10:16450067-16450089 GGCATGGGAATGGATATTAAGGG - Intronic
1066167324 10:32801517-32801539 TGCATGAGAATGAATATTAAGGG - Intronic
1066543427 10:36474202-36474224 AGCATGGGAATGCATATTAAGGG + Intergenic
1067125892 10:43515151-43515173 GGCATGGGAATGGATATTAAGGG - Intergenic
1067332854 10:45337956-45337978 GGCATGAGAATGGATATTAAGGG + Intergenic
1067512238 10:46905736-46905758 GGCTCAAGCATGCACATTAACGG + Intergenic
1067650006 10:48146086-48146108 GGCTCAAGCATGCACATTAACGG - Intergenic
1068018244 10:51545009-51545031 GGCTGGAAAGTGCAAATTAAAGG - Intronic
1068837537 10:61570860-61570882 GGCATGGGAATGGATATTAAGGG - Intergenic
1071267386 10:83976255-83976277 GGCATGGGAATGAATATTAAGGG - Intergenic
1071689818 10:87805221-87805243 GGAATTAGAATACACATTAAAGG - Intronic
1071887225 10:89964287-89964309 TCCAGGATAATGCACAGTAATGG + Intergenic
1071937406 10:90547059-90547081 GGCATGGGAATGGATATTAAGGG + Intergenic
1071943074 10:90610042-90610064 GGCATGGGAATGGATATTAAGGG - Intergenic
1072593363 10:96847803-96847825 AGCAAGAGAATGTAAATTAATGG + Intronic
1073554529 10:104435918-104435940 GGCATGGGTATGCACATTCATGG + Intronic
1073557035 10:104463641-104463663 GGCATGGGAATGGATATTAAGGG + Intergenic
1074897862 10:117792644-117792666 GGCAGGAGAATGGGCAAGAATGG + Intergenic
1075606576 10:123815848-123815870 GGCATGGGAATGCATAGTAAGGG + Intronic
1075754061 10:124796776-124796798 GGCAGGAGAATGCAAAGGAAAGG - Intergenic
1076927716 10:133501493-133501515 GGCATGGGAATGGATATTAAGGG - Intergenic
1079234963 11:18681630-18681652 CGCAGGAGAATGGTCTTTAAGGG - Intergenic
1079470015 11:20769262-20769284 GGCAGAGGAGTGCACAATAAAGG + Intronic
1080131699 11:28802994-28803016 GGTAGAAAAATGGACATTAAAGG - Intergenic
1080976553 11:37349574-37349596 GGCATGGGAATGGATATTAAGGG + Intergenic
1081072494 11:38628831-38628853 GGCATGAGAATGGATATTAAGGG + Intergenic
1081608736 11:44545571-44545593 GGCATGGGAATGGATATTAAGGG + Intergenic
1082915003 11:58423922-58423944 GAGAGGAAAATGCACATTAAGGG + Intergenic
1082999325 11:59277271-59277293 GGCATGGAAATGCATATTAAAGG + Intergenic
1083092854 11:60218831-60218853 GGCATGGGAATGAATATTAAGGG + Intronic
1084041106 11:66543221-66543243 GGCAGGAGAAGGCCCAGTTATGG - Intronic
1084865917 11:72057300-72057322 GGCAGGAGAACGAGCATTGAAGG - Intronic
1085685660 11:78619906-78619928 GGCATGGGAATGGAGATTAAGGG + Intergenic
1086278331 11:85158189-85158211 GGCATGGGAATGGATATTAAGGG + Intronic
1086343764 11:85874486-85874508 GGCTCAAGAATGCACATTAGTGG + Intronic
1086833830 11:91598112-91598134 GGCATGGGAATGGATATTAAGGG + Intergenic
1088407910 11:109500948-109500970 GGCATGGGAATGGATATTAAGGG - Intergenic
1088449055 11:109963069-109963091 GGCAAGGGAATGAACATTAAGGG + Intergenic
1090320749 11:125841449-125841471 GGCAGAAGAATCCACATATAAGG + Intergenic
1091662242 12:2393097-2393119 GGCAGGACAGTGCACTTTCAAGG - Intronic
1092091853 12:5810192-5810214 GGGAGGAGAAAGTACATTAGAGG + Intronic
1092554211 12:9539224-9539246 GGCAGGACAATCCAAACTAAGGG + Intergenic
1094305107 12:29009858-29009880 GGTAGGAATATGAACATTAAAGG - Intergenic
1094517889 12:31151414-31151436 GGCAGGACAATCCAAACTAAGGG - Intergenic
1095603786 12:44043820-44043842 GGCATGGGAATGGATATTAAGGG + Intronic
1095844765 12:46732766-46732788 GGCATGGGAATGGATATTAAGGG - Intergenic
1097821734 12:64134787-64134809 GGCATGGGAATGGATATTAATGG - Intronic
1098715753 12:73827172-73827194 GGCATGGGAATGGATATTAAGGG + Intergenic
1098730770 12:74035090-74035112 GGCATGGGAATAGACATTAAGGG + Intergenic
1099365644 12:81763177-81763199 GGCATGGGAATGGATATTAAGGG + Intergenic
1099400167 12:82194000-82194022 GGCATGTGAATGAATATTAAGGG + Intergenic
1099862153 12:88234221-88234243 GGCAGGGGTATGCAGCTTAAGGG - Intergenic
1102074498 12:110048966-110048988 GTAGGGAGAATGTACATTAAGGG - Intronic
1103035264 12:117651452-117651474 GGCATGGGAATGGATATTAAGGG + Intronic
1103879007 12:124151694-124151716 GGCAGGTTAATGCAAATTGAGGG + Intronic
1104575327 12:129961577-129961599 GTCAGGAGGATGCACTCTAAGGG + Intergenic
1104739086 12:131159504-131159526 GGCAGCAGAATGCACAGGACTGG + Intergenic
1107220680 13:37975801-37975823 AGCAAGAAAATTCACATTAAAGG - Intergenic
1107983869 13:45758248-45758270 GGCATGGGAATGGATATTAAGGG - Intergenic
1108699762 13:52933685-52933707 GGCAGGAGAATCGTTATTAATGG + Intergenic
1108903991 13:55447691-55447713 GGCATGGGAATGAATATTAAGGG + Intergenic
1108914586 13:55591174-55591196 GGCATGGGAATGAATATTAAGGG - Intergenic
1109515988 13:63443021-63443043 TGCATGAGAATGGATATTAAGGG + Intergenic
1109951308 13:69504440-69504462 GGCATGGGAATGGATATTAAGGG - Intergenic
1110217353 13:73037560-73037582 GGCAGAAAAATACACATTACAGG - Intergenic
1110597303 13:77333638-77333660 AGCAGGAGAATGGACAGGAATGG - Intergenic
1111576041 13:90155046-90155068 GGCATGGGAATGGATATTAAGGG - Intergenic
1111865323 13:93760709-93760731 TGCAGGAGAAAGCATATCAAAGG - Intronic
1112232243 13:97600988-97601010 GGGATGAGAAAGCACATTTATGG - Intergenic
1112250229 13:97772498-97772520 GGCATGGGAATGGATATTAAGGG - Intergenic
1114460273 14:22882231-22882253 GGCAGGAGAAGGAACCTGAAGGG + Intergenic
1116259351 14:42602983-42603005 GGCAGGTTAATGCAAATTGAGGG + Intergenic
1116819527 14:49614369-49614391 GGCAACAGAATGCAGATTCATGG - Exonic
1116958688 14:50948480-50948502 GGGAGGAGAAACAACATTAAGGG - Intergenic
1117216526 14:53557826-53557848 GGCATGGGAATGGATATTAAAGG + Intergenic
1117235972 14:53775114-53775136 GTTAGGAGCATGTACATTAATGG + Intergenic
1117596574 14:57332171-57332193 GGCATGGGAATGGATATTAAGGG - Intergenic
1118718379 14:68576292-68576314 GGGAAGAGAATGAACATGAAGGG + Intronic
1118881062 14:69826302-69826324 GGCATGGGAATGGATATTAAGGG - Intergenic
1118950861 14:70435363-70435385 GGCATGGGAATGGATATTAATGG - Intergenic
1120082326 14:80229824-80229846 GGCATGGGAATGAACATTAATGG - Intronic
1120345536 14:83285144-83285166 GGCAGAAAAATGCCCAGTAAAGG + Intergenic
1120556293 14:85932721-85932743 GGCATGGGAATGGATATTAAGGG - Intergenic
1120973355 14:90228181-90228203 GGCATGGGAATGGATATTAAGGG + Intergenic
1121371071 14:93359012-93359034 GGCATGGGAATGGATATTAAGGG + Intronic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1127204077 15:56694782-56694804 GGCAGGAAAAAGAACATTAATGG + Intronic
1129961690 15:79692339-79692361 GGCATGGGAATGGATATTAAGGG - Intergenic
1134558325 16:15185469-15185491 GGCAGGAGAAGGGACATAGAAGG + Intergenic
1134918857 16:18097072-18097094 GGCAGGAGAAGGGACATAGAAGG + Intergenic
1138778742 16:59756596-59756618 GGTAGAAATATGCACATTAAAGG - Intergenic
1138868100 16:60848500-60848522 GGCATGGGAATGGATATTAAGGG + Intergenic
1139978886 16:70837223-70837245 GGCTGGAGAATGCTAATCAATGG + Intronic
1142945907 17:3426905-3426927 GGCACGGGAATGGATATTAAGGG - Intergenic
1143392388 17:6567416-6567438 GGCAGGAGTGTGGACATTAGAGG - Intergenic
1143836122 17:9694334-9694356 GGCAGGAGAAGGGTCATCAAGGG + Intronic
1144213712 17:13036313-13036335 GGCAGGAGAATTCAGAGTCAGGG - Intergenic
1144626073 17:16845076-16845098 GGCAGGAGGATGCAGATGGAGGG - Intergenic
1144880360 17:18427644-18427666 GGCAGGAGGATGCAGATGGAGGG + Intergenic
1145151875 17:20516743-20516765 GGCAGGAGGATGCAGATGGAGGG - Intergenic
1146087972 17:29847875-29847897 GGCAGGTTAATGCAAATTGAGGG - Intronic
1146758536 17:35454877-35454899 GGCATGGGAATGGATATTAAGGG + Intergenic
1147580220 17:41623773-41623795 GGCAGGAGGATGCAGATGGAGGG - Intronic
1149786285 17:59438030-59438052 TTCAGGAGAATGCACATGTAAGG + Intergenic
1150993147 17:70284281-70284303 GGTAGGAGAGTGCATTTTAAAGG - Intergenic
1153131566 18:1859970-1859992 GGCATGGGAATGGATATTAAGGG - Intergenic
1153248407 18:3096047-3096069 GGGAGGACAGTGAACATTAAGGG - Intronic
1155902808 18:31411762-31411784 AGCAGGAAAATGCTCATCAAGGG + Intronic
1156303571 18:35856455-35856477 GGCATGGGAATGGATATTAAGGG + Intergenic
1156732570 18:40212157-40212179 GGCAAGATAATGCAAATGAAGGG - Intergenic
1156990586 18:43402981-43403003 GGCATGGGAATGGATATTAAGGG - Intergenic
1157650687 18:49327239-49327261 AGTAGGAGAATGCAGATAAATGG + Intronic
1158734802 18:60067563-60067585 GGCAGGAGAATGCAGTCAAATGG + Intergenic
1159524900 18:69575807-69575829 AGAAGGAGAAAGCACATTATTGG + Intronic
1159559385 18:69977443-69977465 GGCATGGGAATGGATATTAACGG - Intergenic
1161216078 19:3095571-3095593 GGCAGGAGAATGGCCCTGAAGGG - Intronic
1165134737 19:33660702-33660724 GGCAGGTTAATGCAAATCAAGGG - Intronic
1168539663 19:57199637-57199659 GGCACGGGAATGGATATTAAGGG - Intronic
925460428 2:4058193-4058215 GGCATGGGAATGGATATTAAGGG + Intergenic
925532285 2:4877369-4877391 GAAATGAGAATGCACATTTATGG + Intergenic
925656830 2:6158175-6158197 GGCAGGACAATTCAAAGTAAAGG - Intergenic
926781721 2:16478727-16478749 GGCAGGACTATAGACATTAAGGG - Intergenic
930456558 2:51614051-51614073 GGCATGGGAATGGATATTAAGGG - Intergenic
932608978 2:73184566-73184588 GGCAGGAGCATGCACGGTCAGGG + Intergenic
932870776 2:75395674-75395696 GGCATGGGAATGGATATTAAGGG - Intergenic
933028519 2:77294586-77294608 GGCAGGAGAATGCACATTAATGG + Intronic
933265998 2:80181003-80181025 GGCATGGGAATGGATATTAAGGG - Intronic
933633240 2:84680258-84680280 GCCACGAGAATGCATATCAATGG - Intronic
935056791 2:99574494-99574516 TGCAGGTGAATGTAAATTAATGG - Intronic
935425394 2:102913607-102913629 GGCATGGGAATGGATATTAAGGG - Intergenic
937785492 2:125889988-125890010 GGCATGGGAATGAATATTAAGGG - Intergenic
937852855 2:126650999-126651021 GGCATGGGAATGGATATTAAGGG - Intergenic
939788976 2:146548360-146548382 GGCATGGGAATGAACATTAAGGG - Intergenic
940481556 2:154239488-154239510 GGCAGGAGAATGGAAATTTGAGG + Intronic
940606213 2:155926644-155926666 GGCATGGGAATGGATATTAAGGG - Intergenic
940748451 2:157597211-157597233 GGCAGGTTAATGCACATGCAGGG - Intronic
941330970 2:164176862-164176884 GGCATGGGAATGGATATTAAGGG - Intergenic
942199393 2:173555696-173555718 GGCAGGAGAATGCATTTGCAAGG + Intergenic
944337656 2:198556170-198556192 GGCAGGAGATTGGAGATAAATGG - Intronic
944931636 2:204526177-204526199 GGCAGGCCAATGCATATTGATGG + Intergenic
945726109 2:213473752-213473774 GGCATGGGAATGGATATTAAGGG - Intronic
946570785 2:221021885-221021907 AGCTGGAGAATGAACATTCAAGG + Intergenic
947138085 2:226994980-226995002 GGCAGGAGGCGGCACATTAGAGG + Intronic
947753773 2:232546248-232546270 GGCAGAAAAATGCACATGAATGG - Exonic
1169028462 20:2389297-2389319 GGCTGGAGGATCCACTTTAAAGG - Intronic
1171325012 20:24283461-24283483 GGCAGGTCAATACAAATTAAGGG + Intergenic
1172570709 20:35968167-35968189 GGCAGGCTAATGCAAATTAAGGG + Intronic
1174190491 20:48737036-48737058 GGCAGGTGAATTTATATTAAGGG + Intronic
1174288201 20:49487032-49487054 GGGAGGGGAATGCAGATAAAAGG - Intergenic
1174711514 20:52711180-52711202 GGAAAGAGAATCCAAATTAAAGG - Intergenic
1175178605 20:57129002-57129024 GGCAGGAGACGTCACATTCATGG - Intergenic
1177588026 21:23124864-23124886 GGGAAGAAAATGTACATTAAAGG - Intergenic
1177942143 21:27424311-27424333 GGCTGGACAAAGCACATAAAGGG + Intergenic
1178061038 21:28853430-28853452 GTCATGGGAATGGACATTAAGGG - Intergenic
1181666700 22:24403472-24403494 GAGGGGAAAATGCACATTAACGG - Intronic
1184603866 22:45560678-45560700 GGCATGAGAATGGATATTAAGGG - Intronic
949638487 3:6010235-6010257 GGCATGGGAATGGATATTAAGGG + Intergenic
949944060 3:9176311-9176333 GGCATGAAAATGCATATGAAGGG + Intronic
950102587 3:10367085-10367107 GGGAGGAGAAAGCCCATTAGGGG + Intronic
951003280 3:17590219-17590241 GGCATGGGAATGTACATTAAGGG + Intronic
952243793 3:31562796-31562818 GGCAGCAGGATGCAGTTTAATGG + Intronic
953897692 3:46814784-46814806 GGCATGGGAATGGATATTAAGGG - Intergenic
954512034 3:51133729-51133751 GGCATGGGAATGGATATTAAGGG + Intronic
955590848 3:60533692-60533714 GGCAGGAGAAAGTATAGTAAAGG + Intronic
956471692 3:69573699-69573721 GGCAGGAGAAGGCCAATTATGGG + Intergenic
957247828 3:77735615-77735637 GGCATGGGAATGGATATTAAGGG - Intergenic
959377683 3:105605450-105605472 GGCATGGGAATGGATATTAAGGG - Intergenic
959746309 3:109779536-109779558 GGCATGGGAATGGATATTAAGGG - Intergenic
960495033 3:118363070-118363092 GGCATGGGAATTGACATTAAGGG - Intergenic
960676359 3:120199257-120199279 GGCAGGAGTAAGCACATGAGAGG - Intronic
960823731 3:121760819-121760841 GGCAGCAAAATACACATCAAGGG - Intergenic
961612317 3:128150115-128150137 GGGAGGAGGATGCTTATTAAGGG - Intronic
963254351 3:143130037-143130059 GGTAGGCGAATGCAAATTCACGG + Intergenic
963661092 3:148129851-148129873 GGCATGGGAATAGACATTAAGGG + Intergenic
965996091 3:174884725-174884747 GGCATGAGAGTGTATATTAAGGG - Intronic
966044613 3:175533203-175533225 GGCATGGGAATGTATATTAAGGG - Intronic
966445380 3:179996276-179996298 GGCATGGGAATGGATATTAAGGG + Intronic
967505576 3:190249463-190249485 GGCATGGGAATGGATATTAAGGG - Intergenic
967831469 3:193923700-193923722 GGCATGGGAATGGATATTAAGGG + Intergenic
968351001 3:198051795-198051817 GACAGGAAAATGGACAGTAAAGG - Intergenic
968869767 4:3235830-3235852 GGCAGGAGCATGCTCACTCAAGG + Intronic
968906564 4:3455340-3455362 GGCATGGGAATGGATATTAAGGG + Intergenic
970089488 4:12388639-12388661 GGCATGGGAATGGATATTAATGG - Intergenic
971685258 4:29757299-29757321 GGCATGAGAATGGATATTAAGGG + Intergenic
971816946 4:31502778-31502800 GGCATGGGAATGGATATTAAGGG + Intergenic
971828386 4:31658444-31658466 GGGAGGAGATGGCAAATTAAGGG - Intergenic
971979586 4:33735147-33735169 GGCATGAGAATGAATATTAAGGG - Intergenic
972095224 4:35340401-35340423 GGCATGAGAATGGATATGAAGGG + Intergenic
972192616 4:36612992-36613014 GGCATGGGAATGGATATTAAGGG + Intergenic
974262665 4:59544570-59544592 GGCATGGGAATGGATATTAAGGG - Intergenic
974289304 4:59910482-59910504 GGCATGGGAATGGATATTAAGGG + Intergenic
974479307 4:62423136-62423158 GGCATGGGAATGGATATTAAGGG - Intergenic
974564512 4:63566034-63566056 GGCATGGGAATGAATATTAAAGG + Intergenic
974644906 4:64677060-64677082 GGCATGGGAATGGATATTAAGGG - Intergenic
974726790 4:65809180-65809202 GGCATGAGAAAGGATATTAAGGG + Intergenic
975581850 4:75914159-75914181 TGCAGGACAATGCCCATTACTGG + Exonic
977204357 4:94153016-94153038 GGTATGAGAATGGATATTAAGGG + Intergenic
977430468 4:96925938-96925960 GGCATGGGAATGGATATTAAGGG + Intergenic
977465701 4:97381120-97381142 GGCATGGGAATGGATATTAAAGG + Intronic
978736992 4:112094680-112094702 GGCTGGAGCCTGCACATTTAGGG + Intergenic
978899371 4:113929127-113929149 GGCATGGGAATGCATATTAAGGG - Intronic
980388205 4:132113393-132113415 GGCATGGGAATGGATATTAAGGG - Intergenic
980957474 4:139444088-139444110 GGCATGGGAATGGATATTAAGGG + Intergenic
981799073 4:148635218-148635240 GGAAGAAGAATGTACATTATGGG + Intergenic
981834561 4:149040174-149040196 GGCATGGGAATGGATATTAAGGG + Intergenic
982374402 4:154673825-154673847 TGCAGAATAATGGACATTAAAGG - Intronic
982835211 4:160114282-160114304 GGCATGGGAATGGATATTAAGGG + Intergenic
984061359 4:174992092-174992114 GGCATGGGAATGGATATTAAGGG - Intergenic
984400849 4:179261874-179261896 GGCATGGGAATGGATATTAAGGG + Intergenic
985514081 5:329948-329970 GGCAGGAGAAAGTACATAAAAGG - Intronic
985569462 5:636990-637012 GGCAGGAGAAGGCACAAAACGGG - Intronic
985700464 5:1368839-1368861 GACAGGTCAATGCAAATTAAGGG - Intergenic
986037335 5:3952727-3952749 AGCATGGGAATGCATATTAAGGG - Intergenic
986955829 5:13148422-13148444 GGCACGGGAATGGATATTAAGGG - Intergenic
986959544 5:13196916-13196938 GGCATGGGAATGGATATTAAGGG + Intergenic
987504111 5:18747575-18747597 GGCACGGGAATGAATATTAAGGG + Intergenic
988077578 5:26372639-26372661 GGCAGAAATATGAACATTAAAGG + Intergenic
988080115 5:26403709-26403731 GGCACGGGAATGGATATTAAGGG - Intergenic
988169474 5:27635104-27635126 GGCATGGGAATGGACATTAAGGG - Intergenic
988561827 5:32288591-32288613 GGCATGGGAATGGATATTAAGGG + Intronic
990825703 5:59894813-59894835 TGCAGGAAAATGCTAATTAAAGG - Intronic
991565153 5:67997282-67997304 GGCAGGTGATTGCACAGTGATGG + Intergenic
991945845 5:71897852-71897874 GGCATGGGAATGGATATTAAGGG + Intergenic
992192627 5:74308920-74308942 GGCTGGAGATTGCAAATTCATGG - Intergenic
992784095 5:80153882-80153904 GGCAGAAGAATGCACAATGCAGG + Intronic
993319547 5:86456308-86456330 GACATGGGAATGCATATTAAGGG + Intergenic
993412874 5:87594102-87594124 GGCATGGGAATGGATATTAAAGG - Intergenic
993799578 5:92316123-92316145 TGTAAGAGAATGCACTTTAAAGG - Intergenic
994089698 5:95799281-95799303 GGCAGTAGAATGAGCATTAGAGG + Intronic
994616289 5:102108105-102108127 GGAAAGAGAAAGCACATTGATGG - Intergenic
994836837 5:104865867-104865889 GGCAAGGGAATGGATATTAAAGG + Intergenic
994958172 5:106562044-106562066 GGCATGGGAATGGATATTAAGGG + Intergenic
995269844 5:110207751-110207773 GGCATGGGAATGGATATTAAGGG - Intergenic
995428034 5:112046059-112046081 GGCATGGGAATGAATATTAAGGG - Intergenic
995776602 5:115729968-115729990 GGCATGGGAATGTATATTAAGGG - Intergenic
996266274 5:121544294-121544316 GGCATGGGAATGGATATTAAGGG + Intergenic
998847481 5:146325073-146325095 GGCAGGTGAATCCAGATTGAGGG - Intronic
999351091 5:150872566-150872588 GGCAGGGGAATGGCTATTAAAGG + Intronic
999433042 5:151540377-151540399 GGCAGGAGAAGGGAGATTGAGGG - Intronic
999433052 5:151540421-151540443 GGCAGGAGAAGGGAGATTGAGGG - Intronic
999522789 5:152369685-152369707 GTCAGGGGAATGCATTTTAAAGG - Intergenic
1000736741 5:164912105-164912127 TGCCGTAGAATGCACATTCAAGG + Intergenic
1001106945 5:168862378-168862400 GGCAGCAAAAGGCAGATTAAAGG + Intronic
1003696201 6:8408386-8408408 GGCATGGGAATGGATATTAAAGG - Intergenic
1003758303 6:9147760-9147782 GGCATGGGAATGGATATTAAGGG + Intergenic
1003985195 6:11428173-11428195 GGCAGGAGAATGCATACTGGAGG - Intergenic
1004717528 6:18232371-18232393 GGCAGGAGAAAGAAAATAAAGGG + Intronic
1004824595 6:19405522-19405544 GGCATGGGAATGGATATTAACGG - Intergenic
1005898744 6:30199173-30199195 GTCAGGAGCAAGCACAGTAAAGG + Exonic
1006928662 6:37674027-37674049 GGCAGGAGATTTCACATAATAGG - Intronic
1007811644 6:44490584-44490606 GACAGGAGAATGGAAATAAAAGG - Intergenic
1009308354 6:62120011-62120033 GGCATGGGAATGGATATTAAGGG + Intronic
1010034036 6:71301314-71301336 GGCAGGAGAATGAAAACTATTGG - Intronic
1010116189 6:72315637-72315659 GACAGAAGAATGCATATGAAGGG - Intronic
1010325610 6:74558883-74558905 GGCATGGGAATGGATATTAAGGG - Intergenic
1010818296 6:80385818-80385840 GGCATGGGAATGGATATTAAGGG + Intergenic
1010865953 6:80976977-80976999 GGCAGGTCAATGCAAATTGAGGG - Intergenic
1011618180 6:89217183-89217205 GGCAGGTGAGTGGACATTTAGGG - Exonic
1012921092 6:105221774-105221796 GGCATGGGAATGGATATTAAGGG - Intergenic
1013257839 6:108407036-108407058 GGGAGGAGGATGCTCATTACTGG + Intronic
1013821579 6:114159526-114159548 GTCAGGAGAATGGTTATTAAGGG + Intronic
1014416708 6:121193095-121193117 GGCATGGGAATGGATATTAAGGG + Intronic
1014456137 6:121636844-121636866 GGCATGGGAATGGATATTAAGGG - Intergenic
1014969960 6:127801925-127801947 GGCATGGGAATGGATATTAAGGG + Intronic
1015467226 6:133560522-133560544 GGCATGGGAATGGATATTAAGGG - Intergenic
1015933109 6:138382539-138382561 GGCAGAAGGATGCACAGGAAGGG - Exonic
1016143993 6:140647119-140647141 GGCATGGGAATGAATATTAAAGG + Intergenic
1016420281 6:143875576-143875598 GGCATGGGAATGGATATTAAGGG - Intronic
1016519576 6:144931465-144931487 GGCAGGTCAATGCAAATTGAGGG + Intergenic
1016904400 6:149134622-149134644 GGAAGCAGAATGCACAAAAATGG + Intergenic
1017228116 6:152043376-152043398 GGCATGGGAATGGATATTAAGGG - Intronic
1018107633 6:160504091-160504113 GGCATGGGAATGGATATTAAGGG - Intergenic
1018123273 6:160657818-160657840 GGCATGGGAATGGATATTAAGGG - Intronic
1018599574 6:165525232-165525254 GGCATGGGAATGGATATTAAGGG + Intronic
1019495693 7:1339385-1339407 TGCAGGACAATGCACATAAAAGG - Intergenic
1021958357 7:25849362-25849384 GGCAGGAGAATACATTTTACTGG - Intergenic
1022090658 7:27106090-27106112 GGCAAAAGAAGGCACAGTAAAGG - Intergenic
1023456689 7:40347151-40347173 GGTAGAAGTATGGACATTAAAGG + Intronic
1025075151 7:55936363-55936385 GGTAGAAGGATGCATATTAAGGG + Intronic
1025761867 7:64403208-64403230 GGCATGGGAATGGATATTAAGGG + Intergenic
1026076810 7:67179168-67179190 GGCAGGCCAATGCAAATAAAGGG + Intronic
1026591861 7:71703350-71703372 AGCAGGAGCAGGCACATCAATGG + Intronic
1026700052 7:72633171-72633193 GGCAGGCCAATGCAAATAAAGGG - Intronic
1028141444 7:87279694-87279716 GGCATGGGAATGGATATTAAGGG + Intergenic
1030193060 7:106829250-106829272 GGCTCAAGCATGCACATTAATGG + Intergenic
1030277155 7:107733820-107733842 GGCATGGGAATGAATATTAAGGG + Intergenic
1030554834 7:111010824-111010846 GGCCGGAGAAAGGACATTCATGG + Intronic
1032153416 7:129449221-129449243 GGCATGGGAATGGATATTAAGGG - Intronic
1034169644 7:149053077-149053099 GGCATGGGAATGGATATTAAGGG + Intergenic
1035632069 8:1115742-1115764 GGCATGAGAATTCACATCAGCGG + Intergenic
1037131702 8:15414325-15414347 GGCAGAAATATGAACATTAAAGG - Intergenic
1037139227 8:15499778-15499800 GGGAGGAAAAAGAACATTAATGG - Intronic
1038522496 8:28245220-28245242 GGCAGGAGAATACAGAATTAGGG + Intergenic
1039330321 8:36530581-36530603 GGCATGGGAATGGATATTAAGGG + Intergenic
1042670781 8:71261246-71261268 GACAGGAGAAAACACAATAATGG - Intronic
1043257715 8:78157104-78157126 GGCATGGGAATGTATATTAAGGG + Intergenic
1043260254 8:78186440-78186462 GGCATGGGAATGCATATTAAGGG - Intergenic
1044202102 8:89450196-89450218 GGCATGGGAATGGATATTAAGGG + Intergenic
1044487454 8:92769431-92769453 GGCATGGGAATGGATATTAAGGG - Intergenic
1044633724 8:94302075-94302097 GGCATGGGAATGGATATTAAGGG - Intergenic
1045057759 8:98384030-98384052 GGCAGGAGAATAGAGATTTAGGG + Intergenic
1045221471 8:100204386-100204408 GGCATGGGAATGGATATTAAGGG + Intronic
1045636143 8:104193082-104193104 GGAGGGAGAATGGAGATTAAAGG - Intronic
1046197269 8:110881960-110881982 GGCATGGGAATGGATATTAAGGG + Intergenic
1047691971 8:127365154-127365176 GCCAAGAGAGTGAACATTAAAGG - Intergenic
1048090327 8:131233592-131233614 GGCAGGAGAATGGAAGTAAAGGG - Intergenic
1048538256 8:135317804-135317826 GACAGGAGAATGCACAGGAATGG - Intergenic
1049687700 8:143945526-143945548 CCCAGGAGAATGCACGTTGACGG + Intronic
1050447348 9:5739421-5739443 GGCATGGGAATGGATATTAAGGG - Intronic
1051472914 9:17469682-17469704 GGCAGGAGTAAGCACAATATGGG - Intronic
1052040246 9:23730132-23730154 GGCAGGAGAGGGCAAATTGATGG + Intronic
1052151725 9:25125809-25125831 GGCATGGGAATGGATATTAAGGG - Intergenic
1052368340 9:27638545-27638567 GGCATGGGAATGGATATTAAGGG + Intergenic
1054770428 9:69078352-69078374 GGCAGGAGAGGGCAGATTTAAGG - Intronic
1055489434 9:76789725-76789747 GGCAGGAGAATGTTAATCAATGG - Intronic
1058857746 9:109081551-109081573 GGGAGGTGAATGCACAATCAAGG + Intronic
1061648424 9:132025985-132026007 GGAAGGGGAATGCACAGGAATGG + Intronic
1061738916 9:132684830-132684852 GGAAGGAGGATGCAAAGTAATGG - Intronic
1187543532 X:20224232-20224254 GGAAGGAGAGTGCACATGAATGG + Intronic
1187819179 X:23267847-23267869 GGCAGGAAAATGGAAATAAAAGG - Intergenic
1188359594 X:29236655-29236677 GGCAGGAGAATGCAGGAGAATGG - Intronic
1190554768 X:51623082-51623104 GGCAGGTCAATGCAAATTGAGGG + Intergenic
1191742822 X:64453591-64453613 GGCATGGGAATGGATATTAATGG - Intergenic
1193573968 X:83177263-83177285 GGCATGGGAATGAATATTAAGGG - Intergenic
1193892841 X:87072141-87072163 GGCAGGAGAATGAACCTGAGAGG - Intergenic
1193978959 X:88157918-88157940 GGCATGGGAATGAATATTAAGGG + Intergenic
1194032292 X:88832147-88832169 GGCATGAGAATGGATATTAAGGG - Intergenic
1194179880 X:90698249-90698271 GGCATGAGAATGGATATTAAGGG - Intergenic
1194343025 X:92728818-92728840 GGCATGGGAATGGATATTAAAGG + Intergenic
1194598060 X:95884026-95884048 GGCCGGAGAATCCAGATTACAGG - Intergenic
1195389222 X:104343690-104343712 GGCAGGTTAATGCAAATTGAGGG + Intergenic
1195782670 X:108482161-108482183 GGCATGAGAATGGATATTAAGGG - Intronic
1196372622 X:114996393-114996415 GGCATGGGAATGAATATTAAGGG - Intergenic
1197057345 X:122136350-122136372 GGCAGAAGAGTGCACAGTAAAGG - Intergenic
1197084484 X:122455798-122455820 GGCATGGGAATGGATATTAAAGG - Intergenic
1197097179 X:122610550-122610572 GGCATGGGAATGGATATTAAGGG + Intergenic
1197245403 X:124161607-124161629 GGCATGGGAATGGATATTAAAGG - Intronic
1197387098 X:125814964-125814986 GGCATGGGAATGGATATTAAGGG - Intergenic
1197554558 X:127937844-127937866 GGCATGGGAATGGATATTAAGGG - Intergenic
1197591561 X:128417050-128417072 GGCATGGGAATGGATATTAAGGG + Intergenic
1198933673 X:141885244-141885266 GGCATGGGAATGGATATTAAGGG + Intronic
1199522458 X:148751537-148751559 TGTAGGAGAAAGCACATTACAGG + Intronic
1199627373 X:149752886-149752908 GGCATGAGAATGGATATTAATGG - Intergenic
1200340591 X:155391377-155391399 GGCATGGGAATGGATATTAAGGG - Intergenic
1200526536 Y:4280418-4280440 GGCATGAGAATGGATATTAAGGG - Intergenic
1200651386 Y:5845484-5845506 GGCATGGGAATGGATATTAAAGG + Intergenic