ID: 933029718

View in Genome Browser
Species Human (GRCh38)
Location 2:77313203-77313225
Sequence TGTGCCTCCCGATGTTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 3, 3: 7, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933029713_933029718 8 Left 933029713 2:77313172-77313194 CCCTATTTTTTCCTGAGACCTGT 0: 1
1: 0
2: 3
3: 32
4: 344
Right 933029718 2:77313203-77313225 TGTGCCTCCCGATGTTTTCCTGG 0: 1
1: 1
2: 3
3: 7
4: 157
933029716_933029718 -3 Left 933029716 2:77313183-77313205 CCTGAGACCTGTTGTGGTGATGT 0: 1
1: 0
2: 0
3: 5
4: 126
Right 933029718 2:77313203-77313225 TGTGCCTCCCGATGTTTTCCTGG 0: 1
1: 1
2: 3
3: 7
4: 157
933029714_933029718 7 Left 933029714 2:77313173-77313195 CCTATTTTTTCCTGAGACCTGTT 0: 1
1: 0
2: 4
3: 26
4: 275
Right 933029718 2:77313203-77313225 TGTGCCTCCCGATGTTTTCCTGG 0: 1
1: 1
2: 3
3: 7
4: 157
933029711_933029718 28 Left 933029711 2:77313152-77313174 CCTGTTGCTGTGACGTGCCTCCC 0: 1
1: 0
2: 3
3: 19
4: 111
Right 933029718 2:77313203-77313225 TGTGCCTCCCGATGTTTTCCTGG 0: 1
1: 1
2: 3
3: 7
4: 157
933029712_933029718 11 Left 933029712 2:77313169-77313191 CCTCCCTATTTTTTCCTGAGACC 0: 1
1: 0
2: 5
3: 25
4: 301
Right 933029718 2:77313203-77313225 TGTGCCTCCCGATGTTTTCCTGG 0: 1
1: 1
2: 3
3: 7
4: 157
933029717_933029718 -10 Left 933029717 2:77313190-77313212 CCTGTTGTGGTGATGTGCCTCCC 0: 1
1: 0
2: 0
3: 26
4: 176
Right 933029718 2:77313203-77313225 TGTGCCTCCCGATGTTTTCCTGG 0: 1
1: 1
2: 3
3: 7
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933029718 Original CRISPR TGTGCCTCCCGATGTTTTCC TGG Intronic
906249976 1:44303588-44303610 GGTGCCTTCCTTTGTTTTCCTGG - Intronic
906955735 1:50372220-50372242 TGTGTCTCCCTATGTTGCCCAGG + Intergenic
909995657 1:82276147-82276169 TGTGCCTCCAGATGCTTTACAGG + Intergenic
911669343 1:100590999-100591021 TGAGTCTGCCGATGTTTTCTTGG - Intergenic
912974963 1:114321288-114321310 TGTGCCTCCCCATGTGGCCCTGG - Intergenic
913974525 1:143444265-143444287 GGGGCCTCCCTATGTTGTCCAGG - Intergenic
914068915 1:144269879-144269901 GGGGCCTCCCTATGTTGTCCAGG - Intergenic
914110240 1:144696475-144696497 GGGGCCTCCCTATGTTGTCCAGG + Intergenic
915583094 1:156827586-156827608 TGAGTCTCCCTATGTTTCCCAGG + Intronic
916510598 1:165469412-165469434 TATACCTCCTGATGTTTTCCAGG - Intergenic
1062814039 10:486381-486403 TCTGCCTCCAGATGTTTCTCTGG + Intronic
1063108300 10:3012941-3012963 TGTTCCTACTGATGTTTACCAGG + Intergenic
1063271197 10:4511730-4511752 AGTGCCTCCCAATGTCTTCTTGG + Intergenic
1063331620 10:5165328-5165350 TCTGACTCCAGATTTTTTCCAGG - Intergenic
1063716324 10:8530462-8530484 TGTGTCTCACTATGTTGTCCAGG + Intergenic
1066049854 10:31622953-31622975 TGTCCTTCCAGATGTTTTCTAGG - Intergenic
1066380857 10:34900205-34900227 TGTGTCTCCTGTTGTTTTTCTGG + Intergenic
1067460637 10:46455639-46455661 TGGGTCTCCCTATGTTGTCCAGG - Intergenic
1067626554 10:47928964-47928986 TGGGTCTCCCTATGTTGTCCAGG + Intergenic
1068660508 10:59618403-59618425 TGTGCCTCCCTCCTTTTTCCTGG - Intergenic
1068733263 10:60383853-60383875 AGTGCTTCCTGATGTTTTACAGG - Intronic
1069277963 10:66616466-66616488 TGTTCCTCCAGGTCTTTTCCTGG + Intronic
1069364558 10:67683881-67683903 TGTTCCTCCCGATGGGTTCACGG + Intronic
1070522692 10:77268170-77268192 TGTGCTTCCCCATCTTCTCCTGG - Intronic
1071684628 10:87741947-87741969 TGGGTCTCACTATGTTTTCCAGG + Intronic
1074115972 10:110457767-110457789 TGTGCCTTCCGAGGTTCACCTGG - Intergenic
1076549241 10:131267386-131267408 TGGGCCTCCCGATGCTCTCAGGG - Intronic
1077439074 11:2559897-2559919 TGTGGCTTCCGCTGGTTTCCTGG + Intronic
1084149051 11:67279679-67279701 GGTGCCTCCGGATCTCTTCCAGG + Exonic
1085312994 11:75526935-75526957 AGGGTCTCCCTATGTTTTCCAGG + Intergenic
1086233517 11:84598733-84598755 TGGGTCTCCCTGTGTTTTCCAGG - Intronic
1086483269 11:87268305-87268327 GGGGTCTCCCTATGTTTTCCAGG + Intronic
1089465358 11:118681576-118681598 TGGGTCTCCCTATGTTGTCCAGG + Intergenic
1093485002 12:19642764-19642786 GGTGTCTCCCTATGTTGTCCAGG + Intronic
1097230099 12:57505617-57505639 AGTGTCTCACTATGTTTTCCAGG - Intronic
1099287888 12:80738008-80738030 GATGCCTCCCTATGTTGTCCAGG + Intergenic
1103000765 12:117383824-117383846 TGGGTCTCCCTATGTTTCCCAGG + Intronic
1103052466 12:117792144-117792166 TGTGTCTCACCATGTTGTCCGGG - Intronic
1103213712 12:119185663-119185685 AGTGCCTCTCTATGTTGTCCAGG + Intronic
1103787647 12:123445380-123445402 AGTGCCTCCCTATGTTGCCCAGG + Intergenic
1104316888 12:127711236-127711258 TGTGCCTGACGATCATTTCCAGG + Intergenic
1105026007 12:132849469-132849491 TGTGTCTCTCACTGTTTTCCTGG - Intronic
1105452490 13:20512435-20512457 TGGCCCACCTGATGTTTTCCAGG + Exonic
1106692848 13:32137050-32137072 AGTGACTCCTGATGTTTGCCAGG + Intronic
1108474542 13:50800843-50800865 TCTGTCTCCTTATGTTTTCCTGG + Intronic
1112092024 13:96091656-96091678 TGCCCCTGCCGATGGTTTCCTGG + Intronic
1118453979 14:65928981-65929003 AGTTGCTCCTGATGTTTTCCAGG + Intergenic
1118532134 14:66718356-66718378 TGTTCCTCCCGATGGGTTCGTGG + Intronic
1119482892 14:74970226-74970248 GGTGCCTCCCTATGTTGCCCAGG - Intergenic
1119938510 14:78615741-78615763 TGTGTCTCACCATGTTGTCCAGG - Intronic
1121748740 14:96327054-96327076 TTTGTCTCCCTATGTTTCCCAGG - Intronic
1125924400 15:43550335-43550357 AGTGTCTCCCTATGTTGTCCAGG + Intronic
1128601665 15:69000202-69000224 TGGGGCTCCCGATGTATCCCAGG + Intronic
1128906479 15:71472106-71472128 AGGGCCTCCCTATGTTTCCCAGG + Intronic
1129979896 15:79859078-79859100 TGTGCCTCCCCATTTATTCCAGG - Intronic
1130262730 15:82371180-82371202 GGTGTCTCCCTATGTTTCCCAGG + Intergenic
1130528303 15:84725662-84725684 TGGGCCTCCCTATGTTGTCCAGG - Intergenic
1131226918 15:90631771-90631793 AGGGTCTCCCTATGTTTTCCAGG + Intronic
1132001642 15:98186459-98186481 GGTGCCTCATGATATTTTCCTGG - Intergenic
1132458039 16:35136-35158 TGTCCCTCCCGAAGGTTTTCTGG - Intergenic
1133098375 16:3463671-3463693 TGGGTCTCCCTATGTTGTCCAGG - Intronic
1134698683 16:16245495-16245517 TGAGTCTCCCTATGTTGTCCAGG - Intronic
1134973151 16:18549178-18549200 TGAGTCTCCCTATGTTGTCCAGG + Intronic
1140324776 16:73991132-73991154 TGTGTATCCTGATTTTTTCCTGG - Intergenic
1142083117 16:88160671-88160693 TGTGCCTCCCGCTGTTGTTAGGG + Intergenic
1143663748 17:8344113-8344135 AGGGCCTCCCTATGTTGTCCAGG + Intronic
1146003622 17:29147154-29147176 TGTGCCTCCCATTGTTTTCCAGG - Intronic
1147276542 17:39322132-39322154 AGTGTCTCACTATGTTTTCCAGG - Intronic
1147415326 17:40285135-40285157 TGGGTCTCCCTATGTTGTCCAGG + Intergenic
1149306562 17:55352842-55352864 AGGGCCTCACTATGTTTTCCAGG - Intergenic
1149487106 17:57051146-57051168 GGTGCCTGCTGATGTTTTCCGGG - Intergenic
1150641524 17:66952973-66952995 TGTGCATCCCTGTGTGTTCCTGG - Intergenic
1151835630 17:76581128-76581150 TCTGCCTCCCTTTGGTTTCCAGG + Intronic
1153067486 18:1062771-1062793 TGTGCCTCCTGGTGGTTTCTTGG + Intergenic
1153305376 18:3626102-3626124 TGGGTCTCCCTATGTTGTCCAGG - Intronic
1153738015 18:8092954-8092976 TGGGCCTCTCTATGTTGTCCAGG - Intronic
1154023617 18:10686466-10686488 AGTGCCTCCCTATGCTGTCCTGG - Intronic
1158799055 18:60884345-60884367 GGTGCCTCCCTGTGTTGTCCAGG - Intergenic
1159902380 18:74059738-74059760 GGGGCCTCCCTATGTTGTCCAGG - Intergenic
1160769465 19:823807-823829 TGTGGCTGCGGCTGTTTTCCTGG + Intergenic
1160984540 19:1832236-1832258 TGGGCCTCCCGAAGGCTTCCGGG - Intronic
1162910568 19:13845905-13845927 TCTTCCTCTCGATGTCTTCCTGG - Intergenic
1163744978 19:19041023-19041045 AGGGCCTCCCCATGTTGTCCAGG + Intronic
1166211002 19:41306531-41306553 TGTGCCACCCTGTGTGTTCCCGG - Exonic
927312033 2:21642114-21642136 TGTGCGTCACAAAGTTTTCCAGG + Intergenic
927796191 2:26051127-26051149 TGGGCCTCACTATGTTGTCCAGG + Intronic
928736984 2:34302749-34302771 TTTGCCTGCCTGTGTTTTCCTGG - Intergenic
932556924 2:72832749-72832771 TGGGCCTCTCTATGTTGTCCAGG - Intergenic
933029705 2:77313127-77313149 TGTGCCTCCCTATGTTTTCCTGG + Intronic
933029718 2:77313203-77313225 TGTGCCTCCCGATGTTTTCCTGG + Intronic
933029736 2:77313279-77313301 TGTGCCCCCCTAACTTTTCCTGG + Intronic
933029748 2:77313317-77313339 TGTGCCCCCCTACCTTTTCCTGG + Intronic
933029772 2:77313393-77313415 TGTGCCTCCCTACGTTTTCCTGG + Intronic
933029784 2:77313470-77313492 TGTACCTCCCTATGTTTTCCTGG + Intronic
933029791 2:77313508-77313530 TGTTCCTCCCTACGTTTTCCTGG + Intronic
934179229 2:89605240-89605262 GGGGCCTCCCTATGTTGTCCAGG - Intergenic
934289515 2:91679508-91679530 GGGGCCTCCCTATGTTGTCCAGG - Intergenic
937165290 2:119808613-119808635 AGGGCCTCCCTGTGTTTTCCAGG + Intronic
944488962 2:200237856-200237878 AGGGCCTCCCTATGTTGTCCAGG - Intergenic
945660244 2:212677076-212677098 TGTTCCTCCCAAAGTTATCCAGG + Intergenic
947053216 2:226070734-226070756 TTTGCCTTCCTATGTCTTCCTGG + Intergenic
947897318 2:233687709-233687731 AGTGTCTCCCTATGTTGTCCAGG - Intronic
1169628583 20:7600112-7600134 TGTGCCTCCAAATGTCATCCGGG - Intergenic
1172046100 20:32081341-32081363 TGAGCTACGCGATGTTTTCCAGG - Intronic
1172928439 20:38562882-38562904 GGTGTCTCGCTATGTTTTCCAGG - Intronic
1178018291 21:28377788-28377810 TGTGGTTTCAGATGTTTTCCAGG - Intergenic
1179454689 21:41490941-41490963 TGTGCCTCCGGAGGTCTGCCAGG + Intronic
1182597799 22:31435554-31435576 TGGGCCTCGCTATGTTGTCCAGG - Intronic
1184066043 22:42121644-42121666 AGTGTCTCCCAATGTTGTCCAGG - Intergenic
950838256 3:15941299-15941321 TGTTCCTCCCGATGGGTTCATGG + Intergenic
954117229 3:48473580-48473602 TCTGTCTCCCCATGTTCTCCCGG + Intronic
960295626 3:115940089-115940111 TGTTCCTCCCGGTGGTTTCGTGG + Intronic
961161614 3:124731224-124731246 TCTGCCTACCCACGTTTTCCCGG - Intronic
962682428 3:137814252-137814274 GGTGTCTCCCCATGTTTCCCAGG + Intergenic
966359384 3:179118829-179118851 AGTGTCTCCCTATGTTGTCCAGG - Intergenic
967040984 3:185691928-185691950 TGGGTCTCCCTATGTTGTCCAGG + Intronic
967043467 3:185715431-185715453 CCTGCCTCCCGGTGTTTACCTGG - Intronic
974270588 4:59646508-59646530 TGGGCTTCCCAATGTTGTCCAGG + Intergenic
974834529 4:67231610-67231632 TGGGTCTCCCCATGTTTCCCAGG - Intergenic
978525892 4:109664615-109664637 TGGGTCTCCCTATGTTGTCCAGG + Intronic
980064804 4:128174714-128174736 CTTGCCTCCCGATCTATTCCTGG + Intronic
980313074 4:131160710-131160732 AGAGCCTCCTTATGTTTTCCAGG - Intergenic
980895870 4:138859619-138859641 TGTGTCTCTGTATGTTTTCCTGG + Intergenic
981041083 4:140222706-140222728 TGTCCCTCACTATGTTGTCCAGG - Intergenic
982253795 4:153433190-153433212 TGTGCCTCCCGCTGTTTCTCTGG - Intergenic
982892622 4:160875319-160875341 CTGGCCTCCCCATGTTTTCCTGG + Intergenic
993010931 5:82481979-82482001 AGTGTCTCCCTATGTTTCCCAGG - Intergenic
995622870 5:114046994-114047016 AGGGTCTCCCTATGTTTTCCAGG - Intergenic
998162011 5:139818351-139818373 TGGGCCTCCCTATGTTGCCCAGG - Intronic
998804165 5:145902292-145902314 AGTGTCTCACTATGTTTTCCAGG + Intergenic
1003106459 6:3220296-3220318 CGGGCCTCCCTATGTTATCCAGG + Intergenic
1004269802 6:14185013-14185035 AGTGTCTCCCTATGTTGTCCAGG + Intergenic
1004880604 6:20003568-20003590 GCTGCTTCCCGATGGTTTCCAGG + Intergenic
1006226324 6:32539597-32539619 TGTTCCTCCCGATGGGTTCGTGG - Intergenic
1006795806 6:36731690-36731712 TGTGCCTCCCCATCATTCCCGGG + Intronic
1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG + Exonic
1013022627 6:106234330-106234352 TGTGCCTCCCCCTGTATTTCAGG + Intronic
1014287170 6:119513742-119513764 TGTGCTTATCGAAGTTTTCCTGG + Intergenic
1014474238 6:121853231-121853253 GGAGTCTCCCTATGTTTTCCAGG + Intergenic
1017809056 6:157970946-157970968 ACTGCCTCACGATATTTTCCAGG - Intergenic
1025946374 7:66107965-66107987 AGAGCCTCCCTCTGTTTTCCAGG - Intronic
1026272220 7:68846383-68846405 TGGGTCTCCCGATGTTGCCCAGG + Intergenic
1027415237 7:77967362-77967384 CGGGCCTCCCTATGTTTCCCAGG + Intergenic
1027432018 7:78124269-78124291 TGGGCCTCCACATGGTTTCCTGG - Intronic
1027590598 7:80114054-80114076 TGTTCCTCCCGGTGTGTTCGTGG - Intergenic
1030431090 7:109450107-109450129 TGGGCATCCTGTTGTTTTCCAGG + Intergenic
1032228475 7:130053134-130053156 TATTCCTCCACATGTTTTCCTGG - Intergenic
1032964843 7:137084239-137084261 TGTGCCTCTCTATTTGTTCCTGG - Intergenic
1035199355 7:157250512-157250534 GGTGTCTCCCTATGTTGTCCAGG + Intronic
1036704734 8:11038730-11038752 GATGCCTCCCTATGTTGTCCAGG + Intronic
1037495482 8:19436713-19436735 AGTGTCTCCCTATGTTTCCCAGG - Intronic
1038295774 8:26290429-26290451 TGGGTCTCCCTATGTTCTCCAGG + Intergenic
1039801496 8:40960536-40960558 AGGGCCTCCCTATGTTGTCCAGG - Intergenic
1040743599 8:50611947-50611969 TGGGTCTCCCCATGTTGTCCAGG + Intronic
1042138216 8:65652423-65652445 TGGGTCTCCCTATGTTATCCAGG + Intronic
1044397852 8:91734804-91734826 TGGGTCTCACCATGTTTTCCAGG + Intergenic
1045162505 8:99564398-99564420 TGTGCTGCCGGATGTTTCCCAGG - Intronic
1051955508 9:22688151-22688173 TGTTCCTCCCGGTGGGTTCCTGG - Intergenic
1052399301 9:27980376-27980398 TGTGCCTTACCATGTTTTTCTGG - Intronic
1053357708 9:37460672-37460694 GGGGTCTCCCTATGTTTTCCAGG - Intronic
1057862392 9:98651621-98651643 TGGGTCTCGCTATGTTTTCCAGG + Intronic
1060181602 9:121538171-121538193 TCTCCTTCCCCATGTTTTCCTGG - Intergenic
1061926834 9:133810065-133810087 TGTGCCTGACCATGTCTTCCTGG + Intronic
1186847410 X:13544386-13544408 TGAGCCTTCTGCTGTTTTCCAGG + Intergenic
1188318858 X:28710438-28710460 TGTTCCTCTTGATGTTTTTCAGG - Intronic
1194416100 X:93614071-93614093 TGTGCTTTCCAATTTTTTCCAGG + Intergenic
1199347707 X:146761255-146761277 TGTGCCTCCTGCTGGGTTCCTGG - Intergenic
1201863536 Y:18625381-18625403 AGTGCCTCAGGATGTTCTCCAGG + Intergenic
1201869786 Y:18694997-18695019 AGTGCCTCAGGATGTTCTCCAGG - Intergenic