ID: 933033387

View in Genome Browser
Species Human (GRCh38)
Location 2:77361194-77361216
Sequence ATGTGCTAAGAGAAGTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933033387_933033391 13 Left 933033387 2:77361194-77361216 CCCACTCACTTCTCTTAGCACAT 0: 1
1: 0
2: 0
3: 22
4: 223
Right 933033391 2:77361230-77361252 TCATTAAAAAAAAAAAAAATTGG 0: 6
1: 50
2: 736
3: 6666
4: 22570
933033387_933033392 14 Left 933033387 2:77361194-77361216 CCCACTCACTTCTCTTAGCACAT 0: 1
1: 0
2: 0
3: 22
4: 223
Right 933033392 2:77361231-77361253 CATTAAAAAAAAAAAAAATTGGG 0: 4
1: 32
2: 483
3: 4539
4: 25441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933033387 Original CRISPR ATGTGCTAAGAGAAGTGAGT GGG (reversed) Intronic
901227039 1:7619496-7619518 ATGAGGTAAGAGAAGTGTGAAGG - Intronic
901294133 1:8147572-8147594 CTATGCTCTGAGAAGTGAGTGGG - Intergenic
905328715 1:37176758-37176780 GGGTGGTAAGAGAAGTGAGAGGG + Intergenic
905961993 1:42050724-42050746 ATGTACTAAGAGAATTGAAGAGG - Intergenic
907114086 1:51953333-51953355 ATGTGGGGAGAGAAGTGAGGTGG + Intronic
909488145 1:76197216-76197238 ATGTGCTAAATGAAGAGTGTTGG + Intronic
909939326 1:81592363-81592385 ATTTACAAAAAGAAGTGAGTTGG + Intronic
910380147 1:86618025-86618047 AAGTGTTAAAATAAGTGAGTTGG - Intergenic
910841308 1:91564670-91564692 ATGAGGTGACAGAAGTGAGTGGG + Intergenic
911102180 1:94103764-94103786 ATGGACTAAGAGAAATGAGTTGG + Intronic
911553826 1:99317960-99317982 AAATGTTAAGAGTAGTGAGTAGG - Intergenic
911878408 1:103199820-103199842 GTCTGCTAAAATAAGTGAGTTGG - Intergenic
912154906 1:106905443-106905465 TTGTCCAATGAGAAGTGAGTGGG + Intergenic
913374826 1:118139675-118139697 TTATGCTAAGTGAAATGAGTTGG + Intronic
916772624 1:167927066-167927088 ATGTGCCAACAGAACTGAATTGG + Intronic
918136137 1:181675485-181675507 ATGTGTTAAGAGAAGGGGATGGG + Intronic
918466846 1:184829375-184829397 ATGTGCTAAGTGGTGTAAGTTGG - Intronic
920340795 1:205274019-205274041 AGGTGCAGAGAGATGTGAGTTGG - Intergenic
922000488 1:221472854-221472876 ATGAGTTAAGAGAAATGAGATGG + Intergenic
923981029 1:239324136-239324158 ATGTGCTAAGAGAAAGAAATTGG - Intergenic
1063599920 10:7471495-7471517 ATGTGCTAAGACAATTCAATGGG + Intergenic
1064709695 10:18110720-18110742 AGGGGATCAGAGAAGTGAGTAGG + Intergenic
1066286912 10:33976579-33976601 ATGTTCTAAGAGAAATGGGTGGG + Intergenic
1071789767 10:88941518-88941540 ATGTGATAGGAGAGGTGAGGTGG + Intronic
1072460798 10:95616944-95616966 ATTAGCAAAGAGAACTGAGTTGG + Intronic
1073024808 10:100480108-100480130 ATGACCTAAGAGAAGAGAGCAGG - Intronic
1073050448 10:100663612-100663634 ATGTGCCAAAAGCAGGGAGTGGG + Intergenic
1073446034 10:103580840-103580862 ATGTACAAAGAGAAGGGGGTAGG - Intronic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1073711175 10:106044339-106044361 ATGCTCTAAGAAAAGTGAGTGGG - Intergenic
1074189729 10:111125180-111125202 GTGAGCTCAGAGAGGTGAGTGGG - Intergenic
1074343961 10:112662608-112662630 ATGTGCTAACTGTAGTGACTAGG + Intronic
1075457109 10:122591997-122592019 GTGTGCTCAGAGTAGGGAGTGGG + Intronic
1077758168 11:5058904-5058926 ATGTGCTGAGGGACTTGAGTCGG + Exonic
1079172425 11:18108964-18108986 ATATGATAAAAGAAATGAGTTGG - Intergenic
1080176836 11:29373536-29373558 ATTTGCCAACAGAGGTGAGTTGG - Intergenic
1083320479 11:61842887-61842909 CTGTGCTAAGACATCTGAGTTGG - Intronic
1085564463 11:77500866-77500888 CTGTGGTAAGAGAAGTCTGTTGG - Intergenic
1089667498 11:120029662-120029684 CTGTGCTGTGAGGAGTGAGTTGG + Intergenic
1092675089 12:10907888-10907910 ATGTGTTGAGAGAATTGAGAGGG - Intronic
1093998867 12:25673116-25673138 ATCTGATCACAGAAGTGAGTAGG - Intergenic
1096443873 12:51670631-51670653 CTGTGCTTAGAGAGGTGAATGGG + Intronic
1098088944 12:66880273-66880295 ATCTGCTAAAAAAAGGGAGTTGG + Intergenic
1100616001 12:96232194-96232216 ATGTGGTTGGAAAAGTGAGTGGG + Intronic
1106370541 13:29128274-29128296 ATGTTCAATGAGGAGTGAGTTGG + Intronic
1107066706 13:36221322-36221344 ATGTGCTACATGAAGTGATTCGG + Intronic
1108258815 13:48636767-48636789 ATGTTCTAGGAGCAGTAAGTAGG + Intergenic
1109364025 13:61332174-61332196 ATGAGCTAGGGCAAGTGAGTTGG - Intergenic
1113897030 13:113771132-113771154 GGGTGCTAAGAGAAGGGTGTGGG - Intronic
1115304221 14:31917372-31917394 ATGTGCTCAGAGAAGTGCATAGG - Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1116998421 14:51347763-51347785 ATTTGCTATGAGATTTGAGTGGG - Intergenic
1117918888 14:60707082-60707104 ATGTGGCTAGAGATGTGAGTAGG + Intergenic
1121842165 14:97143824-97143846 AAGTGCTAAGATGAGAGAGTTGG + Intergenic
1122164152 14:99808780-99808802 ATGTTCTAAGGGCAGTGAATTGG - Intronic
1122748653 14:103916813-103916835 ATGTGAAAGGAGCAGTGAGTGGG - Intronic
1125967557 15:43886622-43886644 CTGTGCTATGAGCAGTGAGTAGG + Intronic
1126417472 15:48432876-48432898 ATGTGCTCAGAGAAGACCGTAGG - Exonic
1126795672 15:52258908-52258930 ATGTGCAAGGAGTAGTGAGCTGG - Intronic
1127869089 15:63055344-63055366 ATCTGGGAAGAGAGGTGAGTAGG - Intronic
1131703801 15:94970873-94970895 GTGTGCTGATAGAAGTGAGTGGG + Intergenic
1131727040 15:95238090-95238112 ATGTGCTAAGTAAAGTTAGGTGG - Intergenic
1131972556 15:97906787-97906809 ATGGGCTAAGTGAAGAGGGTAGG - Intergenic
1131983196 15:98016199-98016221 ATGTGTTAAGAGAGAGGAGTTGG - Intergenic
1136774405 16:32863978-32864000 AAATGCTCAGAGAATTGAGTTGG - Intergenic
1136896206 16:33997536-33997558 AAATGCTCAGAGAATTGAGTTGG + Intergenic
1137473703 16:48787603-48787625 ATGTGCTAAGATACTTCAGTGGG - Intergenic
1137483000 16:48867969-48867991 AGGTGAGCAGAGAAGTGAGTTGG - Intergenic
1137586238 16:49665402-49665424 GTTTGCTAGGAGAAGTGTGTGGG + Intronic
1138249401 16:55490507-55490529 ATGTGCTCAGTGCAGTGAGCAGG + Intronic
1140897432 16:79337135-79337157 ATTTGTTAAGACGAGTGAGTGGG + Intergenic
1203076832 16_KI270728v1_random:1126114-1126136 AAATGCTCAGAGAATTGAGTTGG - Intergenic
1142621490 17:1168317-1168339 AAGTGCTAAGCGATGTGAGCCGG + Intronic
1143926854 17:10378730-10378752 AGTTGCTAAGAGAAGGGAGGGGG - Intergenic
1144591292 17:16526117-16526139 ATGTGCTAAGAGAATTAAGCTGG + Intergenic
1144739873 17:17575867-17575889 ATCTGGTGAGAGAAGTGGGTGGG - Intronic
1145110855 17:20159891-20159913 ATCTGCTTAGAGAGTTGAGTGGG + Intronic
1149446133 17:56714703-56714725 ATGTGCTAGGGAAGGTGAGTGGG - Intergenic
1150291388 17:63984424-63984446 ATGAGCTGGGAGAAGTTAGTGGG - Intergenic
1150344356 17:64392807-64392829 ACATGGTAAGAGAAGTAAGTTGG + Intronic
1150782748 17:68135921-68135943 ATGAGCTAAGACAAATGAGCTGG + Intergenic
1151459981 17:74248725-74248747 AAGTGCTCAGAAAAGTGACTGGG - Intronic
1152972878 18:181983-182005 AGGTGCTAAGACAATTCAGTGGG - Intronic
1153151785 18:2104458-2104480 ATGTGTTAACAGAGGTGAGTAGG + Intergenic
1153305264 18:3625085-3625107 ATCTCCTTAGAGAAGTGGGTGGG - Intronic
1155068012 18:22285381-22285403 ATGTGCCAAAAGTAGTGACTGGG + Intergenic
1156315696 18:35966918-35966940 ATGTGGCAAGAGCAGTGAGACGG + Intergenic
1156426518 18:37019551-37019573 ATGTGCTCAGAGATGTGCCTAGG + Intronic
1156942333 18:42783669-42783691 TTCTGCTTAGAGGAGTGAGTTGG + Intronic
1157038032 18:44000397-44000419 ATGATCAAAGAGAAGTGACTTGG - Intergenic
1157987208 18:52451652-52451674 ACATCCTAAGAGAAGTGTGTGGG + Intronic
1159334852 18:67048733-67048755 CTGAGCTAAGAGGAGGGAGTTGG - Intergenic
1159734147 18:72073605-72073627 ATCTTCTAAGGGAAGTGTGTAGG + Intergenic
1160057984 18:75503940-75503962 ATTTGCTAAGAATAGTGAGAAGG + Intergenic
1163884047 19:19950415-19950437 ATGTTGTAAGAGAAGTGAATGGG - Intergenic
1164445261 19:28312092-28312114 ATGTGGCAAGAGAATGGAGTAGG + Intergenic
1165278824 19:34779606-34779628 ATCTCCTAAGAGATGTGAGTTGG - Intergenic
926992917 2:18698977-18698999 ATGTGCTAAGAGAATGGATTTGG + Intergenic
927586430 2:24310552-24310574 ATGTGCTAACAGAAGGCACTAGG + Exonic
929342045 2:40831747-40831769 ATGGGCCAAGAGAAGAGAGTAGG + Intergenic
930328859 2:49956974-49956996 AATTCCTAAGAGAGGTGAGTTGG + Intronic
932467109 2:71931005-71931027 TTGTGCTAAGAGAAGGCAGGAGG + Intergenic
932914887 2:75846313-75846335 ATGTGATAAAAGAAGAGAATGGG - Intergenic
933033387 2:77361194-77361216 ATGTGCTAAGAGAAGTGAGTGGG - Intronic
933153182 2:78939545-78939567 ATGTTCTAAGAGATGGGATTTGG + Intergenic
934591156 2:95551217-95551239 ATGTGCTTAGAGTGGTGAGGGGG - Intergenic
936413564 2:112282616-112282638 ATATGCTTAGATAAGAGAGTGGG - Intronic
936559886 2:113528244-113528266 ATGTGCTGCCAAAAGTGAGTGGG - Intergenic
936660451 2:114537195-114537217 ATGAGCTCAGGGATGTGAGTTGG + Intronic
937081162 2:119140985-119141007 ATGTGCTATGAGAGATGAGAAGG + Intergenic
939135841 2:138292083-138292105 ATGGCCTAAGAGAACTGAGAGGG - Intergenic
940225810 2:151400011-151400033 ATTTGCTAAGAACAGTGTGTGGG - Intergenic
941599273 2:167520415-167520437 GTCTGATAAGAGGAGTGAGTAGG + Intergenic
942117355 2:172741253-172741275 ATGTGAAAAGAGAAGTAAGCAGG - Intronic
942378988 2:175367940-175367962 ATGTGGTCAGAAAAATGAGTTGG + Intergenic
942558291 2:177194762-177194784 ATGTGCTAAGAGAAAGGAAAAGG + Intergenic
943341689 2:186690094-186690116 TTGTGCTAAGAGTAATGAGGAGG + Intergenic
944791711 2:203137100-203137122 CCGTGCTAAGAGAACGGAGTTGG + Intronic
947352432 2:229260374-229260396 AGGTGCTAAAAGGAATGAGTTGG + Intronic
947510125 2:230744922-230744944 ATTTGCTTAGAGAAAAGAGTGGG - Intronic
1168884073 20:1232881-1232903 AAGTCATAAGAGAAGTGATTAGG + Intronic
1170089973 20:12580047-12580069 ATGTCCAAAGAGTAGTGAGGAGG - Intergenic
1172650043 20:36496388-36496410 ATGTACTAGGTGAAGTGCGTGGG - Intronic
1176073937 20:63240037-63240059 CTGTTCTTAGAGAAGTGGGTGGG + Intronic
1182058799 22:27382084-27382106 ATGTGCAAAGTGCACTGAGTGGG + Intergenic
1183085551 22:35484735-35484757 AAGGGCTAAGAAAGGTGAGTGGG - Intergenic
951669208 3:25161655-25161677 ATGTACTAAGAAAAGTGGGAAGG - Intergenic
952399080 3:32947415-32947437 GTCTGATAAGAGAAGTGATTGGG - Intergenic
952686578 3:36156654-36156676 ATGTCATAAGAGATGTGAGGTGG + Intergenic
952978254 3:38714509-38714531 ATTTGCTCAGAGAAGTGGGGTGG + Intronic
953235117 3:41099681-41099703 ATGTGCAAAAAGAATTGTGTGGG + Intergenic
953969778 3:47338080-47338102 ATGTCAGAAGAGAAGTGACTAGG - Intronic
954714720 3:52521332-52521354 ATGGGGTAGGAGAAGTGAGGTGG - Intronic
955431651 3:58851871-58851893 TTTTGATGAGAGAAGTGAGTAGG + Intronic
955459394 3:59163947-59163969 ATGTGCTAAGAGAAATCAGAAGG - Intergenic
956807502 3:72830697-72830719 ATGGGCTAAGTGAGGAGAGTGGG - Intronic
958029833 3:88095374-88095396 ATGTACTAAGAGAAGTGACAGGG + Intronic
958564634 3:95793967-95793989 TTGTGGTAATACAAGTGAGTTGG - Intergenic
959912107 3:111774949-111774971 ATGTGCCATAAGGAGTGAGTTGG + Intronic
959979505 3:112499497-112499519 AGGTGGTAAGAGAGGAGAGTAGG + Exonic
960450549 3:117801568-117801590 CAGTGCTAAGAAAAGTGAGATGG - Intergenic
960822617 3:121750158-121750180 ATGAGCTGTGAGAAGGGAGTGGG + Intergenic
960929032 3:122825528-122825550 ATGTAGAAACAGAAGTGAGTGGG - Intronic
961927864 3:130501806-130501828 ATATGCTAAGAGAATGTAGTAGG + Intergenic
964358714 3:155871832-155871854 ACGGTCTAAGAAAAGTGAGTTGG - Intronic
964633413 3:158836438-158836460 ATGTGCTAAGAGAGGTGTGGAGG + Intergenic
964671682 3:159233186-159233208 ATGTTCCAAGAGAATTAAGTCGG + Intronic
964764996 3:160171038-160171060 ATGTGGTCATAGAAGTGAATAGG + Intergenic
965617653 3:170611425-170611447 ATGTGGTCAGAGAGGTAAGTTGG - Intronic
965958610 3:174402153-174402175 ATGTGCATAGAGATGTGTGTGGG - Intergenic
968919876 4:3516964-3516986 AGGTGGGAAGAGAAGTGTGTGGG + Intronic
969073756 4:4560855-4560877 ATGTCCAAAGAGAAGGGAGGAGG - Intergenic
969271253 4:6104895-6104917 ATGTCCTCAGAGAGATGAGTAGG - Intronic
970352715 4:15219786-15219808 ATTTGCAAAAAGAACTGAGTTGG + Intergenic
970407859 4:15780805-15780827 AACAGCTAAAAGAAGTGAGTTGG + Intronic
971868304 4:32202271-32202293 GGGTGCCAAGAGAATTGAGTAGG - Intergenic
973056104 4:45660273-45660295 ATGTTCTAAGAGAAATTAGTAGG - Intergenic
973848288 4:54935262-54935284 ATGGTCTAAGGGAGGTGAGTGGG - Intergenic
975387538 4:73774564-73774586 ATGTGCAATGAGAAGGGTGTGGG - Intergenic
977161935 4:93645589-93645611 ATGTGCTAAGAGATTTAATTAGG - Intronic
978275738 4:106947609-106947631 ATCTGATAAGGAAAGTGAGTTGG + Intronic
979399613 4:120232565-120232587 GAGTGCTGAAAGAAGTGAGTGGG + Intergenic
980557306 4:134425521-134425543 AGATGCTAATAAAAGTGAGTAGG - Intergenic
981310893 4:143297268-143297290 ATGTCCTAAGAGTGGTGACTGGG - Intergenic
985100733 4:186455876-186455898 ATGTTCTAAGAAAAGAGAGAGGG - Intronic
986706764 5:10459382-10459404 ATGTGTGAAGAGAAGTGATGAGG - Intronic
987509955 5:18824723-18824745 ATGTGCTGAGAGAGGGGAGTGGG + Intergenic
988913457 5:35869263-35869285 CTCTGCTAAGAGAAGTGGGAAGG - Intronic
992051304 5:72943470-72943492 ATGTGGTAAAAGAATGGAGTTGG - Intergenic
993443129 5:87980140-87980162 ATCTGTCAAAAGAAGTGAGTAGG - Intergenic
994562151 5:101388718-101388740 AGGTAGTAAGAGAAATGAGTAGG + Intergenic
995425075 5:112012023-112012045 TTGTGCTAAGGGAATTGAGAGGG + Intergenic
995769024 5:115650155-115650177 TTGTGCTAAGACAATTCAGTGGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999591222 5:153148605-153148627 AAATGCTAAGAGAAGTGCATAGG + Intergenic
1000029310 5:157388485-157388507 ATGGGCTTGGAGTAGTGAGTGGG - Intronic
1000481148 5:161775920-161775942 TTGCGCTAAGGGAAGTCAGTAGG - Intergenic
1001151795 5:169235947-169235969 ATGTGAAAAGGGAAGGGAGTGGG - Intronic
1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG + Intronic
1004312029 6:14554294-14554316 TTGTGATATGAAAAGTGAGTAGG + Intergenic
1004818167 6:19335277-19335299 ATGCTCTAGGAGAAGAGAGTAGG - Intergenic
1005168863 6:22958020-22958042 ATGTTAGCAGAGAAGTGAGTGGG - Intergenic
1005436668 6:25819514-25819536 ATGTACTCATAGAAGTAAGTCGG + Exonic
1007077528 6:39077459-39077481 ATGTGCTGAGAGAACTCAGAAGG - Intronic
1008388730 6:50924015-50924037 ATAAGCAAAGAGAAGTGAGAAGG - Intergenic
1011053878 6:83184909-83184931 AGGGGCTAGGAGAAGAGAGTAGG - Intronic
1011936248 6:92781889-92781911 GTGCCCTAAGAGAAGTGAATAGG + Intergenic
1013218292 6:108051713-108051735 TTGTGATAAGAGAGTTGAGTGGG - Intronic
1015118772 6:129678251-129678273 ATGTGCTCAGAGATGTAAGGGGG - Intronic
1016594171 6:145780817-145780839 ATGTTGTAAGAGAAGGGACTAGG - Intergenic
1018746788 6:166768595-166768617 ATGTACAGAGAGAGGTGAGTAGG + Intronic
1020631063 7:10640288-10640310 ATGTGCTAGGACAGGTAAGTGGG + Intergenic
1020632656 7:10658053-10658075 TTGTGCTTAGAAAAGTGTGTAGG - Intergenic
1021228970 7:18062477-18062499 ATGAGCGCAGAGAAGTCAGTGGG + Intergenic
1022980050 7:35595808-35595830 ATGTCCTTAGGAAAGTGAGTAGG + Intergenic
1024140434 7:46457708-46457730 AAGTGCTCACAGAAGTGTGTTGG + Intergenic
1026793011 7:73346915-73346937 ATCTGCTAACAGAGGTGGGTGGG + Intronic
1027190468 7:75993373-75993395 AGGTGCTAGGGGAAGGGAGTGGG - Intronic
1027882093 7:83853381-83853403 AGGTGCAAATAGAAGTAAGTCGG + Intergenic
1028850573 7:95533041-95533063 ATCTGTTAAGTGAAGTGAGAAGG - Intronic
1029902254 7:104053940-104053962 ATGTGCTCAGAGATGAGAATGGG + Intergenic
1030456841 7:109785539-109785561 AAGATCTAAGAGAAGAGAGTTGG + Intergenic
1030682316 7:112446931-112446953 AGGTGATGAGAGAAGTGATTTGG + Intronic
1031408164 7:121410294-121410316 ATGTGTTAAGAGAAATGATGAGG - Intergenic
1033117576 7:138639297-138639319 ATATGCCAGGAGAAGTAAGTGGG + Intronic
1033495141 7:141886597-141886619 ATATGCCAAGAAAATTGAGTTGG - Intergenic
1033820580 7:145129966-145129988 ATGTTGTAAGAAAAGTGAATTGG - Intergenic
1033820763 7:145131583-145131605 ACTTGCTAAGAGAATTCAGTAGG - Intergenic
1034697762 7:153069184-153069206 AGATGAGAAGAGAAGTGAGTGGG + Intergenic
1036382918 8:8250345-8250367 ATGTGCTGAAAGAAGATAGTTGG - Intergenic
1041373252 8:57186833-57186855 ATGTGCTAGGACAAGTCACTGGG + Intergenic
1042128779 8:65565737-65565759 CTGTGGTAAGAGAAGGGTGTTGG + Intergenic
1042227575 8:66525920-66525942 ATGTACTAGAAGAAGTGAGCTGG + Intergenic
1042318058 8:67445082-67445104 ATGTGCTTAGAGGAATGAATGGG + Intronic
1043115202 8:76242938-76242960 AAGTTATTAGAGAAGTGAGTTGG - Intergenic
1043212708 8:77544600-77544622 ATCTGCTATGATAAGTGTGTTGG + Intergenic
1043954083 8:86341930-86341952 ATGTGCAAATAGAAGTCAGTGGG - Intergenic
1044315944 8:90750402-90750424 ATGTGCTGAGAGAAGTGCATAGG - Intronic
1045980135 8:108175593-108175615 AAATGCCAAGAGAAATGAGTTGG + Intergenic
1046463047 8:114568000-114568022 ATGTGCTCAGGGAAGCCAGTGGG + Intergenic
1046839418 8:118840782-118840804 ATTTGGTATGAGATGTGAGTAGG - Intergenic
1047233939 8:123022289-123022311 ATGTACAAAGAGAAGTGTTTGGG + Intronic
1048063520 8:130945032-130945054 ATGTGATGAGCGAAGTGATTGGG + Intronic
1049892980 9:88119-88141 ATGTGCTGCCAGAAGTGAGTGGG + Intergenic
1050854066 9:10328478-10328500 ATGGGCAAAGAGAAGTTTGTAGG - Intronic
1050960614 9:11725306-11725328 TTCTGCTGAGAGAAGTGGGTTGG + Intergenic
1051021114 9:12544105-12544127 GAGTGCTAAGAGAAGTGTGAGGG - Intergenic
1053734201 9:41088182-41088204 ATGTGCTGCCAGAAGTGAGTGGG + Intergenic
1056178376 9:84057867-84057889 CTGTAATAAGAGAAGAGAGTTGG + Intergenic
1059325203 9:113500167-113500189 ATGTGCTCAGAGATGTCTGTGGG + Intronic
1060116022 9:120941543-120941565 ATGAGGTCAGAGAAGTGAGAGGG - Intergenic
1060316948 9:122520447-122520469 ATGTGAGAAGAGAACTGAATGGG - Intergenic
1060671261 9:125471625-125471647 CTATGCTAAGGGGAGTGAGTGGG + Intronic
1061311191 9:129763768-129763790 CTGTGCTAATAGCAGTGAGGGGG - Intergenic
1188450435 X:30302890-30302912 AGGTGAAAAGAGAAGTGATTAGG + Intergenic
1189156828 X:38766285-38766307 ATGGGGTTAGAGAAGGGAGTGGG + Intergenic
1189414511 X:40802583-40802605 TTGTGCTAAGAGAGGAGAGGAGG + Intergenic
1190135458 X:47792427-47792449 ATGTGCTAAGATTAATCAGTGGG - Intergenic
1190640505 X:52479435-52479457 AAGTGCCAAGAGAATTCAGTGGG - Intergenic
1190647167 X:52533430-52533452 AAGTGCCAAGAGAATTCAGTGGG + Intergenic
1190816834 X:53937057-53937079 AGGTTCTAAGTGAAGTGAGTTGG - Exonic
1191044176 X:56118332-56118354 ATGCGCTATGAGAATGGAGTTGG + Intergenic
1192113258 X:68386789-68386811 ATTGGCTAAGAGAAGTCAGCTGG - Intronic
1195721856 X:107875786-107875808 TTGTGCTAAGAGAAGAGAAGGGG + Intronic
1195793359 X:108615384-108615406 ATGTGCTAAGAAATGTTAGGAGG - Intronic
1198126185 X:133646307-133646329 ATGTCAGCAGAGAAGTGAGTAGG + Intronic