ID: 933034128

View in Genome Browser
Species Human (GRCh38)
Location 2:77370973-77370995
Sequence CTGTAATACAATTAGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933034121_933034128 25 Left 933034121 2:77370925-77370947 CCATAGGCCCCTCATTAATATGT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 933034128 2:77370973-77370995 CTGTAATACAATTAGTTGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 156
933034122_933034128 18 Left 933034122 2:77370932-77370954 CCCCTCATTAATATGTGATTTCA 0: 1
1: 0
2: 0
3: 22
4: 254
Right 933034128 2:77370973-77370995 CTGTAATACAATTAGTTGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 156
933034124_933034128 16 Left 933034124 2:77370934-77370956 CCTCATTAATATGTGATTTCAAA 0: 1
1: 0
2: 3
3: 36
4: 420
Right 933034128 2:77370973-77370995 CTGTAATACAATTAGTTGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 156
933034123_933034128 17 Left 933034123 2:77370933-77370955 CCCTCATTAATATGTGATTTCAA 0: 1
1: 0
2: 2
3: 36
4: 354
Right 933034128 2:77370973-77370995 CTGTAATACAATTAGTTGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933034128 Original CRISPR CTGTAATACAATTAGTTGGT TGG Intronic
901349276 1:8578401-8578423 TTGTAATACCCTTAGTTGTTAGG - Intronic
901906417 1:12415919-12415941 CTGTAATCCGAGTACTTGGTGGG + Intronic
903645653 1:24894503-24894525 CTCCAATACTTTTAGTTGGTAGG + Intergenic
907887438 1:58606568-58606590 CTGTAATAACCTGAGTTGGTTGG + Intergenic
909251352 1:73360763-73360785 CTGGAACACAATCAGTTGGTTGG - Intergenic
909544302 1:76827674-76827696 CTGAGATACCATTAGTTGTTAGG - Intergenic
911063928 1:93770800-93770822 CTGAAATACAATTTGTTAGTAGG - Intronic
911160213 1:94676399-94676421 CTGTACTACAACTATTAGGTAGG - Intergenic
911696210 1:100893091-100893113 ACCTAATGCAATTAGTTGGTAGG + Intronic
911697255 1:100904654-100904676 CTGTCAGACCACTAGTTGGTTGG + Intronic
913036499 1:114971015-114971037 CTGTAATGCCTTGAGTTGGTTGG + Intronic
915422999 1:155800075-155800097 CTGTAATCCAGTTACTTGGGAGG + Intronic
916326282 1:163563308-163563330 CTGTAATAGAATCACTTGGAAGG + Intergenic
917882154 1:179347528-179347550 ATGTGATATAATTAGTTGCTTGG + Intronic
922852140 1:228741898-228741920 CTTTAATGTGATTAGTTGGTTGG + Intronic
923440855 1:234018868-234018890 CTCTAATATAATTTTTTGGTTGG + Intronic
923799210 1:237190633-237190655 CTGTTATATAAATAGTTGTTAGG - Intronic
1068334415 10:55613646-55613668 ATTTAATACACTTAGTTTGTAGG - Intronic
1068528685 10:58160482-58160504 CTGTAATACACTTAGACGGGTGG + Intergenic
1069289374 10:66758623-66758645 TTGATATACAATTAATTGGTGGG - Intronic
1075697059 10:124444253-124444275 CTGTAATCCCATTACTTGGGAGG + Intergenic
1077776563 11:5278647-5278669 CTGTAATCCAACTACTTGGGAGG - Intronic
1080020716 11:27556724-27556746 CTTTAATACAATTTTTTGGGGGG - Intergenic
1082918575 11:58466808-58466830 CTGTAATCCCAGTATTTGGTAGG + Intergenic
1083494487 11:63038946-63038968 CTGGACTTCTATTAGTTGGTAGG + Intergenic
1083838182 11:65286378-65286400 CTGTAATATAATAAATTCGTGGG + Intronic
1085850645 11:80115634-80115656 CTTTACTACACTTAGTTGTTTGG + Intergenic
1087406739 11:97740501-97740523 CTGTAAGTCAATTAGTTTGCAGG - Intergenic
1087577811 11:100011403-100011425 CTGTAACACTATTAGCTGGCAGG - Intronic
1088061273 11:105653895-105653917 CTAGAATACAATTAGTTTGTGGG + Intronic
1095877811 12:47101169-47101191 TTGTAATATAATTACTTGTTAGG + Intronic
1096655054 12:53084378-53084400 CTGTAATCCCAACAGTTGGTGGG - Intergenic
1100634132 12:96418686-96418708 CTGTAATCCAGCTACTTGGTAGG - Intergenic
1101099696 12:101379657-101379679 CTGTACAACAAATTGTTGGTTGG - Intronic
1102067827 12:109992966-109992988 ATGTAAAACAATTAATTGGCTGG - Intronic
1103436900 12:120933739-120933761 CTGTAGTTCAACTAGTTGGGAGG - Intergenic
1104106245 12:125662380-125662402 TAGTAAAACAATTAATTGGTAGG + Intergenic
1105314244 13:19242773-19242795 CTGTAATAGCTTGAGTTGGTTGG - Intergenic
1112864899 13:103883118-103883140 CTGCAATACAACTAGTTAGAAGG + Intergenic
1115063652 14:29226676-29226698 CTGGAATACAATCAGATGTTAGG - Intergenic
1118179430 14:63477091-63477113 CTGTAATCCAAATATTTAGTAGG - Intronic
1121215651 14:92245708-92245730 CTGTAATCCAACTACTTGGGAGG - Intergenic
1124576725 15:30915747-30915769 CTGTAATCCCATTATTTGTTTGG - Intronic
1126540741 15:49820168-49820190 ATGTATTGCATTTAGTTGGTAGG + Intergenic
1129666106 15:77580201-77580223 CTGAAATACAATTCATGGGTGGG + Intergenic
1131504991 15:93009688-93009710 ATCTAATACAACTAATTGGTTGG + Intronic
1135129786 16:19843856-19843878 CTCCAATACAGTTAGATGGTGGG + Intronic
1136488817 16:30591376-30591398 CTTTAATAAAATGAGATGGTGGG - Intergenic
1138062959 16:53910656-53910678 CTGTAATACCACTACTTGGGAGG - Intronic
1138654491 16:58482902-58482924 CTGTAATCCAACTACTTGGGAGG - Intronic
1139240853 16:65390522-65390544 CTGTATTTCCATTAGTGGGTTGG + Intergenic
1139763822 16:69210143-69210165 CTGTAATCCAACTACTTGGGAGG - Intronic
1140416780 16:74779653-74779675 CTGTAATCCAGTTACTTGGGAGG - Intergenic
1144192584 17:12860056-12860078 CTGGACTCCAAGTAGTTGGTTGG + Intronic
1146834349 17:36098349-36098371 CTGTAGGACAATGAGCTGGTTGG - Intergenic
1148395974 17:47308622-47308644 CTGTAATCCAGTTACTTGGGAGG - Intronic
1148940810 17:51209524-51209546 CTGTAAGAAAATAAGTGGGTGGG + Intronic
1149018066 17:51931911-51931933 CTGATATAAAATTAGTAGGTTGG - Intronic
1150180658 17:63116924-63116946 CTGTAAAACAGTTACTTAGTAGG - Intronic
1150361951 17:64543394-64543416 CTGTAATCCAACTACTTGGGAGG - Intronic
1156490303 18:37492060-37492082 CTGTAATTCAATTAGTAGCAAGG - Intronic
1162249980 19:9434300-9434322 TTGTAATACACTTATTTGCTTGG + Intronic
1162269939 19:9605986-9606008 CTGTAATACAGCTACTTGGGAGG - Intronic
1162599881 19:11660356-11660378 CTGTAAAATAATCAGTTGATAGG - Intergenic
1163868450 19:19796157-19796179 CTGTAATCCAGTTACTTGGGAGG + Intronic
1165757059 19:38299789-38299811 CTGTAATCCAGTTACTTGGGAGG - Intronic
1166813036 19:45525574-45525596 CTGTAATCCAGTTATTTGGGCGG + Intronic
925089463 2:1142020-1142042 CTGCAGTACAAAGAGTTGGTGGG + Intronic
926330620 2:11822326-11822348 CTGTAATCCAACTACTTGGAAGG + Intronic
927398256 2:22680977-22680999 CTGTAATACAGCTACTTGGGAGG + Intergenic
929590397 2:43142082-43142104 CTGTAACACAATTTCTTTGTAGG + Intergenic
929756770 2:44772585-44772607 ATTTAATACAATTAATTGGAGGG - Exonic
930105303 2:47634521-47634543 CTGTATTAGAATTACTTGGAAGG + Intergenic
930574269 2:53127179-53127201 CTGTAATGGCTTTAGTTGGTTGG + Intergenic
931093168 2:58909320-58909342 CTGCAATCCATTTTGTTGGTGGG - Intergenic
932228108 2:70059189-70059211 TTTTAAAAAAATTAGTTGGTGGG - Intergenic
933034128 2:77370973-77370995 CTGTAATACAATTAGTTGGTTGG + Intronic
938691143 2:133790462-133790484 CTGTAAAACAATTAGTTCTCAGG - Intergenic
939858361 2:147388540-147388562 CTTTAACATACTTAGTTGGTAGG - Intergenic
942032798 2:171979683-171979705 CTGTAATACAGTGACTTGGGAGG + Intronic
943834002 2:192495966-192495988 ATGTAATAGTATTAGTAGGTGGG + Intergenic
1170225638 20:13988889-13988911 CTGTAATTCAGTTACTTGGGAGG + Intronic
1170877693 20:20266132-20266154 CTGAAATACATTTAGCTGGGAGG + Intronic
1171985246 20:31655906-31655928 CTGTAATACTAGCACTTGGTAGG + Intergenic
1173627589 20:44484854-44484876 CTGTAATCCAATTCTTTGGGAGG + Intronic
1174635293 20:51994325-51994347 CTTTAATATAAATAGTTGGCTGG - Intergenic
1177258818 21:18701601-18701623 CTGTAATAGTATTAGCAGGTGGG - Intergenic
1178549831 21:33527394-33527416 CTGTAATCCAGTTACTTGGGAGG + Intronic
1179222229 21:39418620-39418642 CTGTAATCCCATTACTTGGGAGG - Intronic
1182537811 22:31018963-31018985 CTGTAACACTATTAGGAGGTTGG - Intergenic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
953343672 3:42157028-42157050 CTGTAATCCAGTTACTTGGGAGG + Intronic
955754059 3:62210065-62210087 CTCTATTTCAATTAGGTGGTGGG - Intronic
957847597 3:85758170-85758192 CTGTCACATAATTTGTTGGTAGG + Intronic
958740760 3:98068076-98068098 CTTTTATATAATTAGTTGATGGG - Intergenic
958790359 3:98644748-98644770 CTGTAATGTCATGAGTTGGTTGG + Intergenic
959026447 3:101245418-101245440 TTATAATACAATTAGTTGTGGGG - Intronic
960344047 3:116510662-116510684 CTGTGATGCAGTTACTTGGTTGG + Intronic
961323773 3:126097511-126097533 CTGTAACACATTCAATTGGTTGG + Intronic
962789581 3:138798969-138798991 CTGTAATCCAGTTACTTGGGAGG + Intronic
963251423 3:143106716-143106738 CAGTAATCCAATTAGTAGATTGG + Intergenic
965015590 3:163153244-163153266 CTGTAATAGCTTGAGTTGGTTGG + Intergenic
966117896 3:176486799-176486821 CTGTAATACCATTGCTTAGTTGG - Intergenic
967017266 3:185493661-185493683 CTGTAATTCAACTACTTGGGAGG - Intronic
967667865 3:192195962-192195984 ATGTAATACAGTTAGATGGGAGG - Intronic
968469466 4:772632-772654 CTGTAATCCAGTTACTTGGGAGG - Intergenic
968665178 4:1817121-1817143 CTGTAATCCAGTTACTTGGGAGG + Intronic
971839220 4:31811961-31811983 CTGTAGAAAAATTTGTTGGTCGG - Intergenic
974553567 4:63413093-63413115 CTGTAATACAAGCATTTTGTAGG + Intergenic
975444464 4:74446231-74446253 ATCTAATACAATTACTTGATGGG - Intronic
976516775 4:85977184-85977206 CTGTAATAAGATCAGCTGGTAGG - Intronic
976562744 4:86521211-86521233 CTGTAATGTATTGAGTTGGTTGG + Intronic
978051008 4:104200143-104200165 CTGTACTTCCTTTAGTTGGTAGG + Intergenic
979522643 4:121686583-121686605 CTGTAATACCATCAGTGGGAAGG + Intronic
979837477 4:125389637-125389659 CTTTCATAGAATGAGTTGGTAGG + Intronic
984649724 4:182257459-182257481 CTCTAAAACAATTAGGCGGTTGG + Intronic
985328132 4:188795967-188795989 ATGTAATAAAATTGGTTAGTGGG - Intergenic
988376427 5:30441044-30441066 CTGTAATCCAAGCACTTGGTGGG + Intergenic
988418237 5:30973438-30973460 CTGTATTACAATTATTTGTTTGG + Intergenic
989295815 5:39825186-39825208 ATGTAATAGAATTAGTTGTTCGG + Intergenic
990593423 5:57289590-57289612 CTGTAATATAATTTGATGTTAGG - Intergenic
990695433 5:58411348-58411370 CTGTAGTAAATTTAGTTGCTTGG + Intergenic
990709752 5:58567083-58567105 CTGTAGTAAAAGGAGTTGGTGGG - Intergenic
991136949 5:63193416-63193438 CTGTAATGAACTAAGTTGGTTGG - Intergenic
993569595 5:89520882-89520904 TTGTTTTAAAATTAGTTGGTTGG + Intergenic
994901179 5:105771515-105771537 CTGTCATACTATTAGTTCTTAGG + Intergenic
996306994 5:122058876-122058898 CTGAAATAATTTTAGTTGGTTGG - Intronic
1002577558 5:180183699-180183721 CTGTAATTCAACTACTTGGGAGG + Intronic
1003949108 6:11101859-11101881 CTGTAATACAGCTACTTGGGTGG - Intronic
1010315744 6:74448055-74448077 CTGTAATCCAAATACTTGGGAGG + Intergenic
1012556268 6:100516346-100516368 CTGTGAAACAATTATTTGGTTGG - Intronic
1014036091 6:116768289-116768311 CTGTAATCCCATTACTTGGTAGG - Intergenic
1014229918 6:118891952-118891974 CTGTTGTACAATTAGATGTTTGG + Intronic
1014640003 6:123897825-123897847 CTGTACTACACTGAGCTGGTCGG + Intronic
1015826481 6:137317848-137317870 CCTTAATTCAATTAGTTGGGAGG + Intergenic
1016428764 6:143961300-143961322 CTGTAAGAGGATCAGTTGGTTGG - Intronic
1017168767 6:151435714-151435736 CTTTAAAACAATTAGTTAGCCGG - Intronic
1018613903 6:165667373-165667395 TTGTTTTACAATTAATTGGTTGG - Intronic
1027803015 7:82780083-82780105 CTGTACTACATTTGGTTGGCAGG + Intronic
1031046552 7:116894921-116894943 CTTTAATATAATTAATGGGTGGG - Intronic
1032737527 7:134706244-134706266 CTGTAATCCAAATACTTGGGAGG + Intergenic
1033061686 7:138115473-138115495 CTGTAAAACAATTAGTACATTGG - Intronic
1033492288 7:141855227-141855249 CTGTAATAAACTCTGTTGGTTGG + Intergenic
1033572416 7:142644166-142644188 CTGTAGAAAAATTAGTTTGTAGG - Intergenic
1033816680 7:145082537-145082559 CTGTAATAGCTTGAGTTGGTTGG + Intergenic
1034112378 7:148549772-148549794 CTGTAATAAAAGTAGTTTGCAGG - Intergenic
1036388542 8:8304523-8304545 CTGAAAGAGAATAAGTTGGTTGG - Intergenic
1040966992 8:53092853-53092875 CTGTAATTCCATTACTTGGGAGG - Intergenic
1042621521 8:70711156-70711178 CTGTTATACAAACTGTTGGTGGG + Intronic
1043668505 8:82849406-82849428 CTGTAATATAATTAATTTTTGGG + Intergenic
1045051448 8:98330760-98330782 CTGTTGGACAAATAGTTGGTAGG + Intergenic
1048051136 8:130817997-130818019 CTGCAAAACATTTAATTGGTTGG - Intronic
1050133869 9:2441448-2441470 CTGTAATAGCCTGAGTTGGTTGG + Intergenic
1050848217 9:10251022-10251044 CTCTAATTCAATTAGTTGGTAGG - Intronic
1051904179 9:22076173-22076195 CTGTAATCCAACTACTTGGGAGG - Intergenic
1055182231 9:73402260-73402282 TTGTAATACTCTGAGTTGGTTGG + Intergenic
1055958571 9:81797759-81797781 ATGTAATAGCTTTAGTTGGTAGG + Intergenic
1185823080 X:3223475-3223497 ATGTAATACAATTGTTTAGTAGG - Intergenic
1188824507 X:34814341-34814363 CTGTCATACAATTTTTAGGTGGG - Intergenic
1192021988 X:67403547-67403569 CTGTAATGTCCTTAGTTGGTTGG + Intergenic
1192789806 X:74370339-74370361 CTGGAATAGAATTATTTGGGTGG + Intergenic
1194189517 X:90817483-90817505 ATGTAATGAAATTAGTTGGTGGG + Intergenic
1194262729 X:91716919-91716941 CTGTAATGGCATGAGTTGGTTGG - Intergenic
1195620103 X:106944390-106944412 CAGTAAAACAATCAGTTGGCAGG + Intronic
1196203469 X:112912443-112912465 CTGTATTCCAATTATTTAGTAGG + Intergenic
1199707365 X:150440367-150440389 AGGTAATACAATGAGTTGGGAGG + Intronic
1200536096 Y:4399373-4399395 ATGTAATGAAATTAGTTGGTGGG + Intergenic