ID: 933040338

View in Genome Browser
Species Human (GRCh38)
Location 2:77457166-77457188
Sequence CTCTGGGAAATGACTAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933040338 Original CRISPR CTCTGGGAAATGACTAGGAT TGG (reversed) Intronic
901126477 1:6932520-6932542 CTCGGGTAAATGCCTAGGAGTGG + Intronic
903190488 1:21653086-21653108 CCCTGGGAAATGACGAGTCTGGG + Intronic
904543307 1:31248659-31248681 CTATGGAAAATGACAAGGAGCGG - Intergenic
905473943 1:38212697-38212719 CTTTGGGAAATCACGAGGGTGGG - Intergenic
906327013 1:44852892-44852914 TTTTGGGTAATGACTAAGATAGG + Intronic
906806948 1:48788300-48788322 CACAGGGTAATGACAAGGATGGG + Intronic
907362597 1:53931286-53931308 CTCTGGGTAATTACTAAGAGTGG + Intronic
908440737 1:64151374-64151396 CTCTGGCAAATGACTCCCATAGG + Intronic
910105951 1:83631290-83631312 CTCTGGGAAAAGCCAGGGATAGG - Intergenic
912934157 1:113988164-113988186 CTCTGGCAAGTGACCAGGCTGGG - Intergenic
914424414 1:147561858-147561880 CTCTAGGGATTGACTAGTATAGG + Intronic
921062489 1:211597420-211597442 TTTGGGGAAATGACTAGGAAAGG + Intergenic
1062935451 10:1382800-1382822 CTCTGGGTAATGCCTAGAAGAGG + Intronic
1064330565 10:14390261-14390283 CGCTGGGAAGGGAGTAGGATGGG - Intronic
1065441957 10:25762165-25762187 CTTTGGGAAATGGCTAGGCCAGG + Intergenic
1067682553 10:48450102-48450124 CTCTGGGAAAGCCCTAGGACTGG - Intronic
1070738495 10:78884717-78884739 CCCTGGGAAACGCCTAGGAGTGG - Intergenic
1071095107 10:81964074-81964096 CTCTGGGAAGGGATTAGCATGGG - Intronic
1072148340 10:92664441-92664463 CTCTTGGAAATGGCTGGGAGGGG - Intergenic
1072545567 10:96434409-96434431 CTCTAGGAAATGTCCAGAATAGG - Intronic
1073621469 10:105053168-105053190 CTTTGGGAAGTGATTAGGTTTGG - Intronic
1074828461 10:117231703-117231725 CTCTGGGCTAGGAATAGGATTGG + Intergenic
1076138148 10:128058839-128058861 CTCTGGTAAAAGACTGGGAAAGG - Intronic
1076309879 10:129497734-129497756 CTTTGGGCAATGACTAGGTCAGG + Intronic
1078224152 11:9377010-9377032 CTCTGGTAAATAGCTAGGAGTGG - Intergenic
1078258589 11:9683028-9683050 CTTTGGGAAATGACCAGATTGGG + Intronic
1079304578 11:19311063-19311085 CTCTGACCAATGACTAGGACTGG + Intergenic
1079330144 11:19526470-19526492 CTCGGGGGAATGAATATGATTGG + Intronic
1079726532 11:23886687-23886709 CTCTGGGAAATACCTAGTAAAGG - Intergenic
1081445217 11:43124661-43124683 CCCTGATAAATCACTAGGATTGG + Intergenic
1081966799 11:47175051-47175073 CTCTGGGGAGTGATTAGGAACGG + Exonic
1083524695 11:63351699-63351721 CACTGGGAAAATACTGGGATTGG - Intronic
1087058939 11:93959865-93959887 CTCTGGGAAAGAACCAGAATAGG - Intergenic
1087777500 11:102269684-102269706 TTCTAGAAAATGACTAGAATTGG + Intergenic
1088210430 11:107448695-107448717 CTTTGGGAGATGACTGGGAATGG + Intronic
1088807834 11:113368103-113368125 CTCTTGAAAATGGCTATGATAGG + Intronic
1089031962 11:115340418-115340440 CTCTGAAAAATAACTAGAATTGG + Intronic
1089327259 11:117665876-117665898 ATCTGGGAAATGAGGAGGTTGGG - Intronic
1091795985 12:3297784-3297806 CTCTGGGAAATGCATGGGGTGGG - Intergenic
1091805818 12:3355115-3355137 CACTGGGAAATGACTCTGGTTGG + Intergenic
1093257314 12:16885967-16885989 AACTGGGAAATGACTAGACTTGG + Intergenic
1094278127 12:28702377-28702399 TTTTGGTAAATGACTAGGAGTGG + Intergenic
1095119507 12:38399969-38399991 CTCTGTGAAATGTCTAAGAAAGG + Intergenic
1097373745 12:58815958-58815980 CTAAGGGAGATGACTAGGAGTGG + Intergenic
1098399145 12:70054660-70054682 CTCTGGGAAAAGCCTAGTTTGGG - Intergenic
1100438755 12:94596122-94596144 TGCTGGAAAATGACTAGGATAGG - Intronic
1102513055 12:113428600-113428622 CTATGGGAGAAGGCTAGGATGGG - Intronic
1103556905 12:121771787-121771809 CTTTGGGAACTGAGTAGCATTGG + Intronic
1104482108 12:129116330-129116352 CTCTAATAAATGACTAGGACTGG - Intronic
1105845508 13:24290589-24290611 CTCTGGGACATGACAAAGACAGG - Intronic
1107334191 13:39335964-39335986 CTCTGGGAAATGGGGAGGAATGG - Intergenic
1110186817 13:72684737-72684759 CTAAGGGAAATGACCAGGCTGGG - Intergenic
1110227921 13:73139462-73139484 CTCAGAGAAATGACTGGGCTGGG - Intergenic
1112403706 13:99099180-99099202 CTCTTGGAAATGGCTAAAATGGG + Intergenic
1114473476 14:22979373-22979395 CCCTGGGCAAAGACTGGGATGGG - Intronic
1116764313 14:49051755-49051777 CTCTTGGAACTGCTTAGGATTGG - Intergenic
1117206174 14:53445917-53445939 AGCTGGGAGCTGACTAGGATAGG + Intergenic
1117505875 14:56402398-56402420 TTATGTGAAATGACCAGGATAGG - Intergenic
1118073940 14:62278001-62278023 CTGTGGTAACTGATTAGGATTGG - Intergenic
1118839689 14:69501058-69501080 CTGTGGGAGATGGCTAGGGTAGG + Intronic
1120241749 14:81957999-81958021 CTTTGGGAAATGAATAGGTATGG - Intergenic
1121252865 14:92513057-92513079 CTCTGGGAAAACACTGGGCTCGG + Intergenic
1122142400 14:99670637-99670659 CTCAGGGAAATGAGAAGGAAGGG - Intronic
1122802182 14:104236966-104236988 CTCTAGGAACTGACTAGGCCTGG + Intergenic
1123040457 14:105488181-105488203 CTCTGGGCAAGGACTGGCATCGG + Exonic
1125083027 15:35697778-35697800 CTCTGTGAAAGGACTGGGGTTGG + Intergenic
1125335208 15:38619969-38619991 CTCTGGAAAATGACTGGCACAGG - Intergenic
1126204218 15:46024886-46024908 ATCTGGGAAATGACCTCGATAGG - Intergenic
1127152001 15:56085473-56085495 TTCTGGGAAGTAACTAGGACAGG + Intergenic
1127602450 15:60551893-60551915 CTCTGTGAAATGAGGAGGTTGGG - Intronic
1129933966 15:79433744-79433766 GTCTGAGAAATGACAAGGAAGGG - Intronic
1131640361 15:94285816-94285838 CTCTGGTTAATGACTAGAAGTGG - Intronic
1133387993 16:5386298-5386320 CTCAGGGAAATGACCAGGTGTGG + Intergenic
1133569888 16:7030893-7030915 CTTTGTCAAATGACAAGGATTGG - Intronic
1133622692 16:7541795-7541817 CTCTGGCAAATGATTTTGATGGG + Intronic
1133835285 16:9362289-9362311 CTCTAGGGAATGACTATGATGGG + Intergenic
1134078036 16:11305933-11305955 CTATGGGAAATGTCCAGAATAGG + Intronic
1134252655 16:12585414-12585436 CACTGAGAAATGCCTAGGACTGG + Intergenic
1134597372 16:15506678-15506700 TTCTGGGAAATTATTAGGAAGGG - Intronic
1135099976 16:19596721-19596743 CTCTGTGAAATGAAAAGGCTGGG + Intronic
1138774143 16:59700487-59700509 GTCTGGAACATGACTAGGATTGG + Intergenic
1139446008 16:66999185-66999207 CTCTGGGAACAGGCTAGGCTAGG + Intronic
1140962043 16:79925052-79925074 CTCTGGTAAATACCTAGGAATGG - Intergenic
1141351617 16:83303472-83303494 CTTTGGGAATTGAACAGGATTGG + Intronic
1147674780 17:42197491-42197513 TTATAGGAAATGTCTAGGATAGG - Intergenic
1148960315 17:51386880-51386902 CTCTGGGGAATGAGAAGGAGTGG - Intergenic
1148979307 17:51558127-51558149 CACAGGGAATTGACTAGGGTTGG - Intergenic
1154291542 18:13112398-13112420 CTATGTGAAATGTCTAGGACAGG + Intronic
1158986633 18:62824224-62824246 CTCGGGTAAATACCTAGGATTGG - Intronic
1159982421 18:74800661-74800683 CAATGAGAAATGACTAAGATTGG - Intronic
1160535507 18:79589504-79589526 CTGTGAGAAATGACTAGGGGCGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161542364 19:4859774-4859796 CCCAGGGAAATGACCAGGAGGGG + Intronic
1161620971 19:5296893-5296915 CTGTGGGGGATGACTAGGCTGGG + Intronic
925262629 2:2541723-2541745 CTCTGGGATGTGGATAGGATGGG - Intergenic
927982526 2:27383210-27383232 TTCTGTGAAATAACTAAGATGGG - Intronic
927986830 2:27417416-27417438 CTCATGGAAATCACTAGAATGGG + Intergenic
928176759 2:29039193-29039215 CTCTTGGAAGTGGCTTGGATCGG + Intronic
928208753 2:29307472-29307494 CTCTGTTGAATGACTGGGATTGG + Intronic
929170213 2:38924973-38924995 CTCTGGCAAATTCATAGGATGGG + Intronic
929927665 2:46229148-46229170 CCCTGGGAAATGAGCAGGAAAGG + Intergenic
930487126 2:52024099-52024121 CTGTGGGTAATGAATAGGGTTGG + Intergenic
930495958 2:52144002-52144024 CTCTGGGAATTGAATAGGAGTGG + Intergenic
931766236 2:65459063-65459085 GTCTGGGAAATGAGGAGGAGGGG - Intergenic
932805677 2:74780745-74780767 TTCTGGGCCAGGACTAGGATGGG + Intergenic
933040338 2:77457166-77457188 CTCTGGGAAATGACTAGGATTGG - Intronic
934616007 2:95771507-95771529 CTCTTGGAAATGACTGGTGTGGG + Intergenic
934644891 2:96053055-96053077 CTCTTGGAAATGACTGGTGTGGG - Intergenic
934706833 2:96487323-96487345 CCCTGGGAAAGGACTGGGATGGG - Intergenic
934838299 2:97609144-97609166 CTCTTGGAAATGACTAGTGTGGG - Intergenic
936903781 2:117513606-117513628 TTCTGGGAAATGACTGGAATTGG + Intergenic
936951610 2:117983173-117983195 TTCTGGAAATTGAATAGGATGGG - Intronic
937008529 2:118540560-118540582 GTCTGGGAAATGGCAAGGACTGG - Intergenic
938192727 2:129298204-129298226 CTCTGGAAAATAATTAGGAATGG + Intergenic
938471303 2:131564985-131565007 CTCTGGACAATAACTAAGATGGG - Intergenic
940267419 2:151853783-151853805 CTCTGGGAAAAATCTAGGATGGG - Intronic
947955004 2:234181668-234181690 CTCTGGGAAAAGAGTAGAAATGG - Intergenic
1168763002 20:362529-362551 CTCTGGGACATGGCAAGGCTGGG - Intergenic
1170879735 20:20286057-20286079 CTTGGAGAAATGACCAGGATGGG - Intronic
1171285960 20:23938237-23938259 CTGTGGGAGCTGACTAGCATGGG + Intergenic
1174356738 20:50003448-50003470 TTCTATGAAATGTCTAGGATAGG - Intergenic
1174424102 20:50419963-50419985 TTCTGGGAAATGGGAAGGATGGG + Intergenic
1174919446 20:54686000-54686022 CTCTGTGAAATGCCCAGAATAGG - Intergenic
1175910729 20:62404381-62404403 CTCTGGGAACAGACTTGGCTTGG - Intronic
1177622046 21:23608756-23608778 CACTGGGAGAAGACCAGGATTGG - Intergenic
1178935970 21:36862004-36862026 TTATAGGAAATGCCTAGGATAGG - Intronic
1179072671 21:38086744-38086766 CTTGGGTAAATAACTAGGATTGG + Intronic
1181294850 22:21828735-21828757 ATCTGGAAAATGACTAAGATGGG + Intronic
1182846147 22:33432713-33432735 TTCTGGGAATGGACTGGGATTGG + Intronic
1183514164 22:38253864-38253886 ATCTGGTAAATGACTAGCATTGG + Intronic
953616385 3:44494163-44494185 CTTTGGAAAATAACTAGGATTGG + Intergenic
954502938 3:51037976-51037998 CTCTGGGATATTACTGGGAGTGG + Intronic
954503083 3:51039406-51039428 CTCTGGGATATTACTGGGAGTGG + Intronic
960389746 3:117063038-117063060 TTCTGGGTAATAACTAGGAGTGG - Intronic
960445951 3:117748874-117748896 TTTTGGGAAATCACAAGGATGGG - Intergenic
960749250 3:120928224-120928246 CTCTGGAAAAGGATAAGGATGGG - Intronic
962154095 3:132926187-132926209 TTATGGGAAATGACTATCATTGG + Intergenic
963238052 3:142974762-142974784 CTCAGGGAAATCACTGGGCTGGG - Intronic
966176991 3:177149141-177149163 CACCGGGAAATGGCTAGCATTGG - Intronic
966761725 3:183425367-183425389 CCCTGGCAAGTGGCTAGGATAGG + Intronic
967890020 3:194358223-194358245 CTCTGGGAAAAGCCCAGGATGGG + Exonic
967971567 3:195003394-195003416 TTCTGGGAAATGAGGAGGTTAGG - Intergenic
969061046 4:4435324-4435346 ATCTGGGAGAGGAATAGGATTGG - Intronic
969717064 4:8872876-8872898 CTCTGCGAAATAACTCGCATCGG - Intergenic
969845413 4:9916656-9916678 CCCAGGGAAGTGACTATGATTGG + Intronic
971355957 4:25895590-25895612 CTCTGGGAAATGAATAGAGGTGG + Intronic
976789045 4:88856596-88856618 CTCTGAGAAGTGATTAGGAAAGG + Intronic
981890986 4:149736827-149736849 CTCTGGTAAATACCTAGGATTGG - Intergenic
983876047 4:172875425-172875447 CTCTGAGGAATGAGAAGGATTGG - Intronic
984786607 4:183573066-183573088 TTCTGGGAAATGAGCAGAATGGG + Intergenic
985943425 5:3157172-3157194 CTCTGGTAAATTACTAAGAGTGG + Intergenic
985984662 5:3504516-3504538 CACTGGGAAATGATTCTGATAGG + Intergenic
986551542 5:8961510-8961532 CTCTGAGAAAGAACTTGGATTGG + Intergenic
986961929 5:13224012-13224034 ATCTGGAACATGACAAGGATGGG + Intergenic
987920650 5:24275868-24275890 AACTGGGAAATGACTATTATTGG + Intergenic
988640095 5:33032387-33032409 CACTGGGGAATCACTAGGCTAGG - Intergenic
993323288 5:86502433-86502455 CTCTGGGAAATGAATAAGAAGGG - Intergenic
996849585 5:127937381-127937403 CTGTGGGAAATAATTAGGCTTGG + Intergenic
998992053 5:147828211-147828233 CTCTGGGGAATAACTGTGATTGG + Intronic
1001244556 5:170096171-170096193 CTCTGGAAAATGCCTCGGCTGGG - Intergenic
1001661883 5:173399619-173399641 CTCTGAGACATGATAAGGATTGG + Intergenic
1002779541 6:355807-355829 CTCTGGGCAATGAAAAGGAAAGG - Intergenic
1006113274 6:31761647-31761669 CTCTGGGAAATGCCCAGCCTGGG - Intronic
1006536730 6:34705155-34705177 CTCTGGGAAGTGAATAGGTGAGG + Intergenic
1007027401 6:38590583-38590605 CTCAGGGAAATGACTAGTTTGGG + Intronic
1007626460 6:43249171-43249193 CTCTGTGAAATGAATAGAGTTGG - Intronic
1009940168 6:70281325-70281347 CCCTGGGAAAAGAATAGGAAAGG + Intronic
1015770151 6:136760617-136760639 CTTTGGGAAGTGATTAGGTTAGG + Intronic
1016203308 6:141440386-141440408 CTTGGGTAAATGCCTAGGATTGG + Intergenic
1017063695 6:150509135-150509157 ATCTGGGAAAGGACTAGAAAGGG - Intergenic
1022368200 7:29745848-29745870 CTCTGGGAAGTGACTGCGTTTGG + Intergenic
1023549279 7:41351888-41351910 CTCTGGGAAATGAATAAAATAGG + Intergenic
1023941153 7:44769083-44769105 CTCTGGGAAGTGACAAGCAGAGG - Exonic
1024604101 7:51010814-51010836 CTCTGGGACAGGACTGGGGTGGG + Intergenic
1025063043 7:55827454-55827476 CTCTGGGACAGGGGTAGGATAGG + Intronic
1025247033 7:57325276-57325298 TTCTGGGAAATGGGAAGGATGGG - Intergenic
1027695685 7:81407171-81407193 CTTTAGGAAATTCCTAGGATTGG - Intergenic
1028011846 7:85655477-85655499 CTCGGGGCAGTGACTGGGATGGG - Intergenic
1028596083 7:92547279-92547301 CTTTGGGCACTGACTAGCATTGG + Intergenic
1030056804 7:105590416-105590438 CTCTGGGAAATACCTAGGAGTGG + Intronic
1030805498 7:113912938-113912960 CTCTAGGGAAAGTCTAGGATGGG + Intronic
1032419354 7:131765379-131765401 CTTTGGGAGGTGATTAGGATTGG - Intergenic
1032796837 7:135284274-135284296 CTCTGCGATATGTCCAGGATAGG - Intergenic
1033646976 7:143312632-143312654 CTCTGGGCAATGATTAAGTTAGG - Intergenic
1037933873 8:22901419-22901441 CTCTTGGAACTACCTAGGATCGG + Intronic
1039091277 8:33832239-33832261 CTCTGGGAAATGATTAGTTCTGG + Intergenic
1039142422 8:34404936-34404958 GTCTGGCAAATGACTTGGCTGGG - Intergenic
1040603046 8:48903290-48903312 CTCTGGGAAATGATTATAATGGG - Intergenic
1040877196 8:52166254-52166276 CTCTGGGAATTGGCTAGCCTGGG - Intronic
1042726472 8:71883707-71883729 ATCTGGAACATGACAAGGATAGG - Intronic
1044812459 8:96077856-96077878 CTCAGGGAGATCACTCGGATGGG - Intergenic
1045795749 8:106041635-106041657 CTCGGGTAAATGCCTAGGAGTGG + Intergenic
1047434250 8:124822678-124822700 CTTCGGGAAATGAATGGGATTGG + Intergenic
1047610184 8:126513179-126513201 CTATGGGAAATAACTAGATTTGG - Intergenic
1051495423 9:17717447-17717469 CTCTGGGAGATGACTTGGGAAGG - Intronic
1052194032 9:25690485-25690507 GTCTGGGAAAAGAACAGGATAGG - Intergenic
1052798556 9:32946503-32946525 CTCTGGGGAGTGACTGGAATGGG - Intergenic
1055626085 9:78178776-78178798 TTCTTGGAAGTGACCAGGATGGG - Intergenic
1055847429 9:80583380-80583402 CAGTGGGAAATGACCTGGATTGG - Intergenic
1056682830 9:88734127-88734149 CTCTGTGAAAGGACAAGGTTTGG + Intergenic
1060618781 9:125044170-125044192 CTTTGGGTAATGACGAGCATGGG + Intronic
1061409762 9:130413800-130413822 CTCTTGCAAAGGACTAGGAAAGG + Intronic
1193007001 X:76631170-76631192 CTCTGGGAAAAGGGTGGGATGGG - Intergenic
1196789743 X:119453176-119453198 CTCTGGGAAATGAGATGGTTTGG + Exonic
1199262322 X:145789827-145789849 ATCTGAGAAATGGCCAGGATAGG + Intergenic
1199387159 X:147236546-147236568 CACTGGGAAATGAAAAGGCTTGG + Intergenic
1201786556 Y:17788657-17788679 CTTTGTGAAATGATTAGCATTGG - Intergenic
1201814997 Y:18117331-18117353 CTTTGTGAAATGATTAGCATTGG + Intergenic