ID: 933041284

View in Genome Browser
Species Human (GRCh38)
Location 2:77470107-77470129
Sequence AAATATATGCCCCTGCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933041284_933041291 18 Left 933041284 2:77470107-77470129 CCGACCAGCAGGGGCATATATTT 0: 1
1: 0
2: 0
3: 10
4: 100
Right 933041291 2:77470148-77470170 CTTCAAAAATGCGTAATACCAGG 0: 1
1: 0
2: 0
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933041284 Original CRISPR AAATATATGCCCCTGCTGGT CGG (reversed) Intronic
900078723 1:838646-838668 AAATAGCAGCCCCTGCGGGTCGG + Intergenic
902338099 1:15765361-15765383 AAAGATGTGCCCCTTCTGGGTGG + Intronic
905548011 1:38815636-38815658 AAATCAAGGCCCCTTCTGGTGGG + Intergenic
905857617 1:41324444-41324466 AAATTGATGCCCTTGTTGGTGGG + Intergenic
906203822 1:43976291-43976313 ATATAGATGCCCCTGGTGGAAGG - Exonic
909259179 1:73465032-73465054 GAACATGTGCCCCTGGTGGTTGG + Intergenic
909546121 1:76849433-76849455 ATGTATATTCCCCTGCTGTTGGG + Intergenic
910969566 1:92842149-92842171 AAATATTTCCCACTGATGGTTGG - Exonic
911048006 1:93644553-93644575 AAGAATGTGCCCCTGGTGGTTGG - Intronic
911797906 1:102097452-102097474 AAACATATCCCCCTCCTGCTTGG + Intergenic
912238302 1:107876728-107876750 AAATATGTGCCACTGCAGTTAGG - Intronic
917946417 1:179976526-179976548 AAATATATGTCCCAGCTACTTGG + Intronic
920453572 1:206079847-206079869 AAATATTTTGCCTTGCTGGTGGG - Intronic
920964226 1:210688963-210688985 AAATATATGCCCCTGTGGGCTGG - Intronic
921664397 1:217850499-217850521 AAAGATGAGCCTCTGCTGGTCGG + Intronic
922035585 1:221844820-221844842 AAATATATACATCTGCTGGTTGG - Intergenic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
1063032425 10:2249189-2249211 AAATTTATCCTCCTGCTGTTTGG + Intergenic
1067126364 10:43519304-43519326 AAATATATGGATCTGCTTGTGGG - Intergenic
1069376387 10:67797455-67797477 ACATAGATGCCTCTGGTGGTGGG + Intronic
1070512823 10:77176748-77176770 AATAATATGCCCCTTTTGGTAGG + Intronic
1073763339 10:106654791-106654813 AGATAACTGCCCATGCTGGTTGG + Intronic
1074195589 10:111181797-111181819 AAATAAATGGCCCTGCTGATGGG - Intergenic
1076222204 10:128743281-128743303 AGACATATGCCACTGCTGGGGGG - Intergenic
1084153764 11:67303101-67303123 AAACATTTCTCCCTGCTGGTCGG - Intergenic
1084580488 11:70020102-70020124 AAACATCTGCCCCAGCTGGGGGG - Intergenic
1088628623 11:111752166-111752188 GAGTATATGCCGCTGCTGGCAGG - Exonic
1088650174 11:111950750-111950772 AAATATATACACCTACTGGTTGG - Intronic
1090453859 11:126830263-126830285 GAATATTTGCAGCTGCTGGTGGG - Intronic
1091336705 11:134774749-134774771 ATATATATGCCTCTGTTGTTAGG - Intergenic
1093859507 12:24146165-24146187 AAATATATGCTGCTACTGTTGGG - Intergenic
1099845710 12:88025550-88025572 AAATATACAACCATGCTGGTTGG - Intronic
1100314795 12:93435078-93435100 AAATATATGTACCTCCAGGTGGG - Intronic
1103208054 12:119145660-119145682 GACTCTCTGCCCCTGCTGGTGGG - Exonic
1106166412 13:27251061-27251083 AAACATACGCACCTGCTAGTAGG - Intergenic
1107453979 13:40537404-40537426 AAATAAATGCCCCTGTAGGATGG + Intergenic
1107834139 13:44400026-44400048 AAATAAATGTCCATGCTGGAAGG + Intergenic
1107862431 13:44673636-44673658 AAAAATATACCCTTGCTGTTTGG - Intergenic
1110002974 13:70229262-70229284 GAATAAATGCCCTGGCTGGTGGG + Intergenic
1110003853 13:70240153-70240175 AAAAATATGCACCTGCAGCTGGG - Intergenic
1110003859 13:70240196-70240218 AATTATATGCACCTGCAGCTGGG - Intergenic
1110246770 13:73334488-73334510 CAAAATATGACACTGCTGGTTGG - Intergenic
1120642913 14:87037316-87037338 AAACATGTGCCCCTTCTGCTTGG - Intergenic
1128167870 15:65483201-65483223 AAATCTAATCCACTGCTGGTGGG + Intronic
1128387021 15:67156954-67156976 AAATACATGCCACTCATGGTAGG + Intronic
1133697132 16:8275457-8275479 TAATATATGCCACTGCCGGCTGG + Intergenic
1137790214 16:51168738-51168760 AAATAAATGTCCATGCTGTTAGG - Intergenic
1144186681 17:12803119-12803141 AAATACAGGCGCCTGGTGGTGGG - Intronic
1144568815 17:16382020-16382042 AAAGATGAGCCTCTGCTGGTCGG - Exonic
1144568851 17:16382248-16382270 AAAGATGAGCCTCTGCTGGTCGG - Exonic
1144568887 17:16382476-16382498 AAAGATGAGCCTCTGCTGGTCGG - Exonic
1145360046 17:22204433-22204455 AAAGATGAGCCTCTGCTGGTCGG - Exonic
1146926050 17:36746253-36746275 ACGTATTTGCGCCTGCTGGTTGG + Intergenic
1154498034 18:14976891-14976913 AATCATACGCCCCTGCTGGGAGG + Intergenic
1157471697 18:47993807-47993829 AAATATATGCCACTTCTTGGTGG + Intergenic
1158864588 18:61625893-61625915 TAACATGTGCCCCTGGTGGTTGG - Intergenic
1159046951 18:63377814-63377836 GAACATATGCCCATGGTGGTTGG - Intergenic
1164556593 19:29257491-29257513 AAATCTAAGCCACAGCTGGTGGG + Intergenic
933041284 2:77470107-77470129 AAATATATGCCCCTGCTGGTCGG - Intronic
933049625 2:77587441-77587463 AAATATATGTCCATGCTCATAGG + Intronic
934220624 2:90078931-90078953 AAATATGTGCCCAAGGTGGTTGG + Intergenic
937609232 2:123840320-123840342 CAATATATGCCCATGAAGGTTGG - Intergenic
938959617 2:136329540-136329562 AAAGATGAGCCTCTGCTGGTCGG + Intergenic
939438244 2:142206556-142206578 TAATATATGCCCCGGGTGGTAGG - Intergenic
939953869 2:148508565-148508587 TAATATATTCCCCCGCTGGAAGG - Intronic
940394078 2:153167238-153167260 AAATGTATGACCCTTCTGTTGGG - Intergenic
942310607 2:174653282-174653304 AAAGATAGGCCCCTGCTTGTTGG - Intronic
946009101 2:216550403-216550425 AAATAGATTCCCATGCTTGTGGG - Intronic
948561237 2:238854696-238854718 AAGTAGATGCCCCTGCTGAAGGG + Intronic
1168877063 20:1179287-1179309 AAATATCTGCTCCTACTGGTAGG - Intronic
1173122610 20:40307484-40307506 AAATCTATGTCCCTGTGGGTGGG - Intergenic
1177451545 21:21274217-21274239 AAATAGATGTCCCTGCTATTAGG - Intronic
1180126671 21:45795875-45795897 AAATAGATACCACTGCAGGTAGG + Intronic
1181035805 22:20169307-20169329 AAACACATCCTCCTGCTGGTGGG + Intergenic
956616256 3:71175719-71175741 AAATATATGCTTTTGCTGCTAGG + Intronic
958446349 3:94220012-94220034 AAATATATTGCACTCCTGGTGGG - Intergenic
965292393 3:166900146-166900168 AAATAGATGCCCCACTTGGTTGG + Intergenic
969903604 4:10372492-10372514 TAATTTATGCCTCTGCTGTTGGG + Intergenic
970374245 4:15440840-15440862 GAATTTATGCTCCTGCTGGCCGG + Intronic
971682485 4:29718324-29718346 AAAAATATGCCCCAGATGTTTGG - Intergenic
971785725 4:31099875-31099897 ATATACCTGCCCCTTCTGGTAGG + Intronic
972777412 4:42255108-42255130 CAATATATGCCTCTACAGGTAGG - Intergenic
981586529 4:146309275-146309297 AAATCTATGCTCCTGAAGGTTGG + Intronic
985043841 4:185919849-185919871 AAATATATGCCACTTCAGGCTGG - Intronic
988003017 5:25373586-25373608 AAATATATACACCTACTGGCCGG + Intergenic
994635633 5:102341915-102341937 AAAAATATGCCACTGCTTGGGGG + Intergenic
995268371 5:110191814-110191836 AAAAATATGCCCCTGAGGCTGGG - Intergenic
996063372 5:119055807-119055829 GAACATATGCCCCAGGTGGTTGG + Intronic
996707564 5:126512871-126512893 AAATATATCCACTTGCTGGGAGG - Intergenic
997492298 5:134287667-134287689 ATAAATATGCCTCTGCTGATAGG - Intronic
999191634 5:149752234-149752256 AGATAAATACCCTTGCTGGTGGG + Intronic
1000139730 5:158390453-158390475 AAATTTGTGACCCTGCTGGATGG - Intergenic
1004954914 6:20718905-20718927 AAATATTTGCCCCTAGAGGTAGG - Intronic
1010364545 6:75034099-75034121 AAATTGATGCCCCTGCTGGATGG + Intergenic
1013354762 6:109336939-109336961 TAAAATATGAGCCTGCTGGTGGG + Intergenic
1015091990 6:129369355-129369377 AAAAATATGGCCCTGCTGTTAGG + Intronic
1017054407 6:150424568-150424590 AAATATCTGCTCCTGCTGCTTGG + Intergenic
1020470428 7:8528238-8528260 CAATCTGTGCCACTGCTGGTGGG - Intronic
1023625914 7:42114995-42115017 AAAATTATGCCTCTCCTGGTCGG - Intronic
1026331683 7:69357498-69357520 AGATGTATGGCCCTGCGGGTGGG - Intergenic
1036472866 8:9066239-9066261 GAAGAGATGCCCCTGCTAGTGGG - Intronic
1036712569 8:11090815-11090837 AAAGATAAGCCCCAGATGGTAGG - Intronic
1043072398 8:75655391-75655413 AAATATATGCTACTGCCAGTTGG - Intergenic
1045774211 8:105782734-105782756 AAATATATGCTCCATATGGTTGG - Intronic
1046595606 8:116257875-116257897 ATATAAATACCACTGCTGGTGGG - Intergenic
1051099286 9:13502671-13502693 AAATTTAAGCCCCAGCTGCTGGG + Intergenic
1057596802 9:96421485-96421507 AAATATAGGCCCCTTCAGCTGGG + Intergenic
1060329964 9:122659112-122659134 AAATATATGTCCCTAGTGGCTGG + Intergenic
1060933812 9:127504699-127504721 AAAAACATGTCCCTACTGGTGGG - Intergenic
1188299978 X:28496152-28496174 AAAAAAATGCCCCTGCTTTTGGG - Intergenic
1197924567 X:131633166-131633188 AAGTATATGTCCCTTTTGGTTGG + Intergenic