ID: 933046104

View in Genome Browser
Species Human (GRCh38)
Location 2:77539308-77539330
Sequence CAAAATGCTGATTGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 39, 2: 82, 3: 83, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933046100_933046104 19 Left 933046100 2:77539266-77539288 CCAAGTTTGGAACTTCCTAGAGA 0: 8
1: 2
2: 0
3: 10
4: 157
Right 933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG 0: 1
1: 39
2: 82
3: 83
4: 264
933046101_933046104 4 Left 933046101 2:77539281-77539303 CCTAGAGACTTGTTAAATTGTTG 0: 65
1: 93
2: 200
3: 783
4: 2563
Right 933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG 0: 1
1: 39
2: 82
3: 83
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933046104 Original CRISPR CAAAATGCTGATTGTGATAT GGG Intronic
901343759 1:8519721-8519743 TAAAATCCTGACTGTGATATGGG - Intronic
901486619 1:9567710-9567732 TAAAATGCAGATTCTGATGTAGG - Intronic
901961525 1:12830072-12830094 CAAAGTCCTGAGTGTGAGATAGG + Intronic
905526269 1:38642213-38642235 CTAAATCCTGGTTTTGATATGGG - Intergenic
905537413 1:38733741-38733763 TAAAATTCTCTTTGTGATATAGG + Intergenic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909076703 1:71057455-71057477 CATAATTGTGAGTGTGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909174910 1:72345091-72345113 CAAAATTTTGATTGTGAAGTAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
911316815 1:96365818-96365840 CAACATGCTAAATGTGCTATTGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911820363 1:102411625-102411647 CAAAATGCTGAGTGTCACACTGG - Intergenic
912089478 1:106053594-106053616 AAAAAGGCTGATTGTCATATGGG - Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
915991372 1:160520472-160520494 TAAAATGCTGATTGGGGAATAGG - Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917308868 1:173656353-173656375 AAAGTTGCTGATTGGGATATTGG + Intronic
917890428 1:179432373-179432395 CAAAGTGCTGATTGTAAACTTGG + Intronic
918547343 1:185700129-185700151 CAAAATGCAGATTCTGATTCAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919589427 1:199481964-199481986 GAAAAAGCTGATTTTGAGATGGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
924601675 1:245495392-245495414 CAAAGTGATGATTTTGGTATAGG + Intronic
1065142795 10:22735687-22735709 CAAACTGGTGGTCGTGATATAGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067181952 10:43994695-43994717 GATAATGGTGATGGTGATATTGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068298859 10:55112675-55112697 TAACATGCTGATCGTCATATGGG - Intronic
1069923758 10:71833864-71833886 CAAACTGCTGATTGAGATCCTGG - Intronic
1070009504 10:72458525-72458547 CAACATGATGATTGTGAAGTTGG + Intronic
1070174101 10:73955949-73955971 AAAAATCCTGATTTTGATTTTGG + Intergenic
1071235009 10:83635043-83635065 TCAAAAGCTGATTCTGATATAGG - Intergenic
1071512079 10:86268336-86268358 CCAAATGCTGTTGGTGATACCGG - Intronic
1071849420 10:89553346-89553368 CAAAATGTTGATTGTCAGAGAGG - Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072312119 10:94166644-94166666 CAAAATGCTGAGTGTAACAGAGG + Intronic
1072374924 10:94804463-94804485 CAAGATGCTGCTTTTAATATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074597118 10:114877640-114877662 CAAAATTCTAATTGAGACATTGG + Intronic
1074903431 10:117839377-117839399 CAAAGTGATGCATGTGATATTGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078234083 11:9467930-9467952 CAAATTGCTCATCGTGACATAGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079277684 11:19056885-19056907 CAGAATGGAGATTGTGATTTAGG + Intronic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080292490 11:30686692-30686714 CAAAATGCTGGTTGTAACAACGG - Intergenic
1080729275 11:34932234-34932256 CAAAATCCAGATTATAATATGGG + Intronic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083206863 11:61156265-61156287 TAAAATGCAGCTTGTGAGATTGG + Intronic
1084293157 11:68189873-68189895 CAATGTTCTGATTGTGATATGGG - Intronic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087351100 11:97033509-97033531 AAAATTGCTGATTTTGATTTTGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090870433 11:130740766-130740788 AAAAAAGCAGATTGTCATATTGG - Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093726428 12:22516152-22516174 CAAGACACTGATTCTGATATAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097582082 12:61470760-61470782 CAAAATGTTCATTATGATAACGG + Intergenic
1097605741 12:61751373-61751395 AAAAATGCTGCTTGTGAAAATGG - Intronic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099124305 12:78733154-78733176 CAAAAAGCTGTTTGTAATATTGG + Intergenic
1099307676 12:80978164-80978186 AAAAATGCTGATTCTGATGGGGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099929350 12:89055688-89055710 CATAACGCTGATTGTGACATGGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101450914 12:104778102-104778124 CAAACTGCTGATTGTGGCAGAGG - Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102417593 12:112777917-112777939 CAAAATGCTTTTTGTCATGTAGG + Intronic
1103113379 12:118302860-118302882 CAAAATGGTAGTCGTGATATTGG - Intronic
1103413693 12:120730297-120730319 GAAAATGCTGATGGTGAGAAAGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105982087 13:25527781-25527803 CAAAATGCTGACTGTGCTTAAGG - Intronic
1108888285 13:55219339-55219361 ATAAAGGCTGATTGTGATATTGG + Intergenic
1109083857 13:57944275-57944297 AAAAGTCCTGGTTGTGATATTGG + Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1111172490 13:84545896-84545918 CCAAATGCTGATTGTCCTGTAGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1112095666 13:96129232-96129254 GAAAATGTTGGTGGTGATATAGG + Intronic
1112687280 13:101844732-101844754 CAAATAGCTGTATGTGATATAGG - Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113845928 13:113391528-113391550 TAAAATCCTGATTGTAATAAAGG + Intergenic
1114084060 14:19225638-19225660 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
1114377676 14:22165934-22165956 AAAAATACTGCATGTGATATTGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115401660 14:32968455-32968477 TAAAATTCTGAAGGTGATATAGG + Intronic
1115935711 14:38549832-38549854 ACATATGCTGATTGTGATAATGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116961317 14:50971085-50971107 CGTAATGCTGATTTTCATATGGG - Intergenic
1117043728 14:51791473-51791495 CAAAATTCTTATTGTCATCTTGG - Intergenic
1117369969 14:55068735-55068757 CAAAATACTGATTATTTTATTGG - Exonic
1118014797 14:61649065-61649087 GAAATTGCTGATTGTAAGATTGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120799874 14:88676000-88676022 CAAAATGCTGATGATGACACAGG - Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1202895670 14_GL000194v1_random:7489-7511 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
1123810950 15:23925756-23925778 CAAAATGGTGACTGTGTAATGGG - Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1129013387 15:72443315-72443337 CAACATGCAGATTGTTACATAGG - Intergenic
1130704726 15:86222312-86222334 CAAAATAATGATTTTGATTTTGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1133495422 16:6312962-6312984 CAAAATGCAAACTGGGATATGGG + Intronic
1133872018 16:9697817-9697839 AAAGATGGTGTTTGTGATATGGG - Intergenic
1135229960 16:20697447-20697469 CAAAATGACAATGGTGATATTGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137939165 16:52665952-52665974 AAAAATGCTTAATGTGATATTGG - Intergenic
1138047644 16:53742391-53742413 CAAAATCCTGATTTTGACCTGGG - Intronic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1145038379 17:19557383-19557405 CAAAATGCTTAATGGTATATAGG + Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1153360956 18:4196389-4196411 AAAAATGCTGATTGCCATGTGGG + Intronic
1153883496 18:9441212-9441234 CAAACTGCTGTTGGTGCTATTGG - Intergenic
1154391659 18:13941828-13941850 CATAATGCCAATTGTGATGTAGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157194549 18:45610198-45610220 CAAAATACAGATTCTGTTATGGG + Intronic
1157793509 18:50554849-50554871 CAAAATGCTCAATGTCTTATAGG - Intergenic
1157929269 18:51803234-51803256 GAAAATGCTGACTGTGATTGTGG - Intergenic
1158782881 18:60673036-60673058 CAAAATTCTGATTGATATTTAGG + Intergenic
1161884203 19:6981079-6981101 CAAATTTCTGAATTTGATATAGG - Intergenic
1164379007 19:27716470-27716492 TAAAATGCTTAGTGTGACATTGG + Intergenic
1165916275 19:39262910-39262932 CAATATGCTGGTTGTGGTATTGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168565315 19:57417476-57417498 TAAAATGCTGGTTGTTATTTTGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926255102 2:11186923-11186945 TAAAATGCTGTTTATAATATAGG - Intronic
927140507 2:20127171-20127193 CAAAATTCTGATGGTGTTAATGG + Intergenic
927835248 2:26392048-26392070 CTAAATGCTGATTGTGGTTTAGG + Exonic
928381819 2:30824530-30824552 CAAGATTCTGCTTGTGTTATGGG + Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930646706 2:53916668-53916690 TAAAATGCTTATTTTAATATAGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933067839 2:77820089-77820111 AAAAATACTTATTGTGATACAGG - Intergenic
933391952 2:81681811-81681833 CAAAATAATTATTTTGATATAGG - Intergenic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
936974725 2:118207690-118207712 TAAAGTGCTGATTCTGATTTAGG + Intergenic
938492531 2:131770443-131770465 CAAAATGCTGGTTTTGTTCTAGG + Intergenic
938495037 2:131791904-131791926 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942537984 2:176985490-176985512 CAAAAAGCTCATTGTCTTATGGG - Intergenic
942789097 2:179738063-179738085 CAAAAGGCAGATTGTGACTTAGG - Intronic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
945511642 2:210710226-210710248 CAAAATGCTGACTTTTATTTGGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947679540 2:232017526-232017548 TAAAATGGTGTTTGGGATATGGG - Intronic
1170046231 20:12088363-12088385 CAAAATGTTGGTTGTGAGAAAGG - Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170903972 20:20494743-20494765 CAAAATGCTAGATGTGATATGGG + Intronic
1172451645 20:35029401-35029423 CAAAAGACAGATTGTTATATTGG - Intronic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1175112462 20:56658217-56658239 CAAAATGAAGATGGTGATAATGG + Intergenic
1176615365 21:9023551-9023573 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177754475 21:25329455-25329477 TAAAATGATGATTCAGATATAGG - Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1178508145 21:33179928-33179950 AAAAATGCTTATTATGATAGAGG + Intergenic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1179495293 21:41767411-41767433 CAATATCCTGGTTGTGAGATTGG - Intergenic
1179578481 21:42322323-42322345 CAGAATTTTGATTGTCATATGGG - Intergenic
1180293913 22:10867565-10867587 CAAAATGCTGGTTTTGTTCTAGG + Intergenic
1180496719 22:15896980-15897002 CAAAATGCTGGTTTTGTTCTAGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1183118229 22:35708485-35708507 CAAATTGCTGATTGTGTTTCAGG - Intergenic
1183852839 22:40605936-40605958 CAAGAAGCTGATTGTGGAATAGG - Intronic
1184908847 22:47512095-47512117 CAAAAGGATTATTGTGATAAAGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951168385 3:19508736-19508758 TAAAATGCAGATTCTGACATGGG - Intronic
951171481 3:19547011-19547033 TTAAATGCTTATTGTGTTATGGG - Intergenic
951394526 3:22149129-22149151 TAAAATGCAGATTCTGATACAGG - Intronic
952389062 3:32864478-32864500 CAAAAAGCAGATTCTGATCTGGG + Intronic
953812140 3:46122036-46122058 CAAAGAGCTGTTTGTGATAATGG - Intergenic
955545383 3:60023053-60023075 CAACATGCTCATTTTCATATTGG - Intronic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
957945559 3:87058298-87058320 CAAAAGCCTGACTGTGATATGGG - Intergenic
958113833 3:89188567-89188589 CAATATGTAGATGGTGATATTGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958493466 3:94809926-94809948 CAAAATCCTGATTCTTATGTAGG + Intergenic
958551524 3:95620010-95620032 CAAAATGGTGATTCTGAAATTGG + Intergenic
958567055 3:95827594-95827616 CCAGATGAAGATTGTGATATAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959332941 3:105029155-105029177 CAACATTCTAATTGAGATATAGG - Intergenic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962783838 3:138747255-138747277 CAAAATGCTACTTGTGATCCTGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965690734 3:171354249-171354271 CAAATTGCTGATTGTAAAAAGGG + Intronic
966012894 3:175103179-175103201 TAAAATGCTGCTTCAGATATAGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966314408 3:178629583-178629605 TACAATGATGATTGTGATCTTGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967044549 3:185724720-185724742 CAAAGTCCAGACTGTGATATGGG - Intronic
968195054 3:196699577-196699599 CAAAATGCTTACTATGGTATTGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970058516 4:12002438-12002460 CAAAATGGTGATTCTAATAATGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971005404 4:22369455-22369477 CAAAATGTTGACTGTGTTAGTGG + Intronic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973539345 4:51920632-51920654 CTAAATGCTGATGAGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975675922 4:76827528-76827550 CACAAAGCTGACTGTGATAAGGG + Intergenic
975936728 4:79590397-79590419 TAAAAAGCTGATTTTGAGATAGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977492171 4:97729588-97729610 CAAATTCCTGATTGTGTAATAGG - Intronic
978450297 4:108826015-108826037 AAAGATGCTGATTTTGAAATAGG - Intronic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983428920 4:167622588-167622610 CAAACTGGTAAATGTGATATTGG - Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986165356 5:5267868-5267890 CAAAGATCTGATTCTGATATGGG - Intronic
986268578 5:6211680-6211702 AAATTTGCTGCTTGTGATATAGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
987938404 5:24500233-24500255 TAAAGTGCTGATTTTAATATTGG - Intronic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990454622 5:55973048-55973070 CATAATGTTCATTGTAATATCGG - Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990867269 5:60393641-60393663 CAAAATGATTATTGTGGAATTGG - Intronic
991074707 5:62522178-62522200 CAAAATGCTGATCTTGAAGTTGG - Intronic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991734371 5:69618238-69618260 ATAAATGTTCATTGTGATATAGG + Intergenic
991780608 5:70128487-70128509 ATAAATGTTCATTGTGATATAGG - Intergenic
991810804 5:70473373-70473395 ATAAATGTTCATTGTGATATAGG + Intergenic
991859896 5:71003910-71003932 ATAAATGTTCATTGTGATATAGG - Intronic
991873056 5:71128806-71128828 ATAAATGTTCATTGTGATATAGG - Intergenic
992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG + Intronic
992994132 5:82315913-82315935 TAAAATGCTCATTGTGATGAAGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993095826 5:83476488-83476510 AAATATGCTGATTGTTACATAGG + Intronic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994056557 5:95423114-95423136 CAAAATGCTCATTGGAATAGAGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994466997 5:100148893-100148915 CAAAATTTTCATTGTTATATTGG - Intergenic
994810690 5:104515217-104515239 CAAACTCCTGTTTGTGAAATTGG - Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995072348 5:107939291-107939313 CAAAATCATGACTGTGATAACGG - Intronic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
997460724 5:134050513-134050535 CAAAATACTGAGTGTGAAATAGG + Intergenic
999003918 5:147955083-147955105 CAAATTCCTGAATGTGATAATGG + Intergenic
999324084 5:150632275-150632297 CAAAATGCAGATTGTAATTCAGG - Intronic
999509366 5:152232345-152232367 CAATATCCTGATTGTGGTAGTGG - Intergenic
999762615 5:154714084-154714106 CAAAATGGGGATTGTAATCTGGG + Intronic
1000205604 5:159055496-159055518 TAAATTGCTCATTCTGATATGGG - Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006508931 6:34511312-34511334 GAAAATGCAGATTCTGATGTGGG + Intronic
1007230446 6:40344295-40344317 CAGAATGCTGATTGACATATAGG - Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008893446 6:56523328-56523350 CAAAACTGTTATTGTGATATAGG + Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009641205 6:66339299-66339321 TAAAATGCTGATTGTTCTAAAGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010106672 6:72177965-72177987 TAAAATCCTTATTTTGATATAGG + Intronic
1010415250 6:75604368-75604390 CAAAATGCTGTGTGTGATTAAGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1011904093 6:92339330-92339352 CAAGATTCTCATTTTGATATGGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014902838 6:126988693-126988715 CAAAATGCCTTTTGTTATATAGG + Intergenic
1014908047 6:127054695-127054717 CAAAATGAAGTTTGTGAAATAGG + Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015662139 6:135588051-135588073 TAAAATGCAGATTTTGATTTAGG + Intergenic
1015689894 6:135910323-135910345 TAAAGTGCTGACTGTGATACTGG - Intronic
1015695028 6:135970504-135970526 TAAAATGCTGATTTTGATTCAGG + Intronic
1018374305 6:163196109-163196131 AGAAATGCTGATTGGGATCTTGG - Intronic
1018381452 6:163261490-163261512 CAAATTGCTGCTGGTGATAATGG - Intronic
1018887688 6:167955061-167955083 CAAAGTGTTCATTGTCATATTGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022562134 7:31360616-31360638 CACAATGCTTAATGTGATACTGG - Intergenic
1023516267 7:41004918-41004940 CAATATGTTTATTGTGACATCGG + Intergenic
1024103202 7:46054762-46054784 CAAAATACTAATTGTGAGCTTGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1025062881 7:55826312-55826334 CAAAATTCTCTTTGTGATATAGG - Intronic
1026238471 7:68550362-68550384 GAAAGTGCTGATTTTGATTTTGG - Intergenic
1026490362 7:70857708-70857730 CACAAGGCTGATTGAGTTATCGG + Intergenic
1027622788 7:80512402-80512424 ATATATTCTGATTGTGATATAGG - Intronic
1028768812 7:94591584-94591606 CCAAATGCTGATTTTGAATTTGG - Intronic
1029676836 7:102075604-102075626 CAAAATGCTGAGTGTTTTTTTGG + Intronic
1030044056 7:105479020-105479042 AAAAATGCTAATTGTATTATGGG - Intronic
1030442046 7:109597866-109597888 AAAAATGCTGTTTGTGTGATGGG - Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031801420 7:126251370-126251392 CAAGATAGTGACTGTGATATTGG - Intergenic
1032863903 7:135906774-135906796 AAAAATCCTGATGGTAATATGGG + Intergenic
1032927473 7:136624044-136624066 GAAAATGCTGATTCTGGTTTAGG + Intergenic
1033317412 7:140309127-140309149 CAAACTGCTGAGTGGGAAATGGG + Intronic
1033562429 7:142545177-142545199 CAAAATGATGATGGAGATGTAGG - Intergenic
1033620777 7:143060491-143060513 AAAAATGCAGATTCTGATTTAGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1036966564 8:13305412-13305434 CAAAATGCTAATTTTTCTATTGG - Intronic
1038377259 8:27053845-27053867 CAATATCCTGGTGGTGATATGGG + Intergenic
1038469504 8:27801995-27802017 CTAAATGCTGAATGTGATACTGG - Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039315250 8:36364586-36364608 TAAAATGCAGATTCTGATTTCGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1042469564 8:69168943-69168965 CAAAAATCTGATTGAGAAATAGG - Intergenic
1043378365 8:79675023-79675045 CAAAATGCTGAGTGTGGTGGTGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043910879 8:85862528-85862550 TAAAATGCAGATTCTGATCTGGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048270983 8:133027749-133027771 CAGAATTCTAATTGTGAAATAGG + Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1048948999 8:139477499-139477521 CAAATTGCTGCTTGTGACAGTGG - Intergenic
1050549264 9:6735171-6735193 CAAACTGCTTAGTGTGAAATTGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050755445 9:8996892-8996914 CTATATCTTGATTGTGATATTGG + Intronic
1050802197 9:9629473-9629495 CAGGATGCTGATTGTAATTTGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052264847 9:26560319-26560341 CAAAAAGCTGATTATAAGATAGG - Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1053646792 9:40125794-40125816 CAAAATGCTGGTTTTGTTCTAGG + Intergenic
1053758925 9:41337774-41337796 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
1054327806 9:63723679-63723701 CAAAATGCTGGTTTTGTTCTAGG + Intergenic
1054537779 9:66250159-66250181 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1056010826 9:82328166-82328188 AAAAATGCTGAATCAGATATGGG + Intergenic
1056796763 9:89663848-89663870 CAAAAGGCTGCTTGAGAAATGGG + Intergenic
1057032493 9:91786652-91786674 CAAAATGTTGACTCTGTTATGGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058219265 9:102276265-102276287 CAAAAGGCTGCTTGTACTATAGG + Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059742318 9:117164191-117164213 CAAAATCATGATTTTCATATGGG + Intronic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186556763 X:10568230-10568252 CACAAAGATGATTGTGATAGAGG + Intronic
1187281682 X:17861697-17861719 GAAAATGCCAATTGTGATACCGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188740750 X:33777431-33777453 CAAAATACTGAATGTGACACAGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189350004 X:40269082-40269104 CAAAATGCTTTTGGTTATATTGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1189974703 X:46449158-46449180 CAAAATGCAAATTGTGAGAAAGG + Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191724571 X:64266232-64266254 CAAAATACAGATTGAGATATGGG + Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193565805 X:83075696-83075718 TAGAATGCTGTTTGTGATACAGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196327125 X:114419804-114419826 CCAAATGCTGACTAAGATATGGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198407517 X:136329256-136329278 CCAAATTCTGGTTGTGATTTGGG - Intronic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201643935 Y:16206462-16206484 CAAAATGCTGGTGGTGTTACTGG - Intergenic
1201658880 Y:16378859-16378881 CAAAATGCTGGTGGTGTTACTGG + Intergenic
1201747298 Y:17391546-17391568 CAAAATGCTGATTTTATTGTGGG + Intergenic