ID: 933046104

View in Genome Browser
Species Human (GRCh38)
Location 2:77539308-77539330
Sequence CAAAATGCTGATTGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 39, 2: 82, 3: 83, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933046101_933046104 4 Left 933046101 2:77539281-77539303 CCTAGAGACTTGTTAAATTGTTG 0: 65
1: 93
2: 200
3: 783
4: 2563
Right 933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG 0: 1
1: 39
2: 82
3: 83
4: 264
933046100_933046104 19 Left 933046100 2:77539266-77539288 CCAAGTTTGGAACTTCCTAGAGA 0: 8
1: 2
2: 0
3: 10
4: 157
Right 933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG 0: 1
1: 39
2: 82
3: 83
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933046104 Original CRISPR CAAAATGCTGATTGTGATAT GGG Intronic