ID: 933046104 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:77539308-77539330 |
Sequence | CAAAATGCTGATTGTGATAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 469 | |||
Summary | {0: 1, 1: 39, 2: 82, 3: 83, 4: 264} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
933046101_933046104 | 4 | Left | 933046101 | 2:77539281-77539303 | CCTAGAGACTTGTTAAATTGTTG | 0: 65 1: 93 2: 200 3: 783 4: 2563 |
||
Right | 933046104 | 2:77539308-77539330 | CAAAATGCTGATTGTGATATGGG | 0: 1 1: 39 2: 82 3: 83 4: 264 |
||||
933046100_933046104 | 19 | Left | 933046100 | 2:77539266-77539288 | CCAAGTTTGGAACTTCCTAGAGA | 0: 8 1: 2 2: 0 3: 10 4: 157 |
||
Right | 933046104 | 2:77539308-77539330 | CAAAATGCTGATTGTGATATGGG | 0: 1 1: 39 2: 82 3: 83 4: 264 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
933046104 | Original CRISPR | CAAAATGCTGATTGTGATAT GGG | Intronic | ||