ID: 933047788

View in Genome Browser
Species Human (GRCh38)
Location 2:77559728-77559750
Sequence GTTTTACTTATTAAAGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933047787_933047788 19 Left 933047787 2:77559686-77559708 CCTGTTAATTAGGGCTTTGTTAA 0: 1
1: 0
2: 0
3: 22
4: 177
Right 933047788 2:77559728-77559750 GTTTTACTTATTAAAGTCTGTGG 0: 1
1: 0
2: 2
3: 20
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933047788 Original CRISPR GTTTTACTTATTAAAGTCTG TGG Intronic