ID: 933053988

View in Genome Browser
Species Human (GRCh38)
Location 2:77638340-77638362
Sequence CACTCTTGGGAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933053988_933054000 22 Left 933053988 2:77638340-77638362 CCCTCCCCCTTCTCCCAAGAGTG No data
Right 933054000 2:77638385-77638407 CCCTCACCAGAAGCTAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933053988 Original CRISPR CACTCTTGGGAGAAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr