ID: 933060846

View in Genome Browser
Species Human (GRCh38)
Location 2:77735002-77735024
Sequence GCCGGCCGGCCCGCAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933060846_933060851 -7 Left 933060846 2:77735002-77735024 CCAGGGCTTGCGGGCCGGCCGGC No data
Right 933060851 2:77735018-77735040 GGCCGGCCGCTCGGACTGCGGGG No data
933060846_933060855 8 Left 933060846 2:77735002-77735024 CCAGGGCTTGCGGGCCGGCCGGC No data
Right 933060855 2:77735033-77735055 CTGCGGGGTGCTCAGAGTGCGGG No data
933060846_933060849 -9 Left 933060846 2:77735002-77735024 CCAGGGCTTGCGGGCCGGCCGGC No data
Right 933060849 2:77735016-77735038 CCGGCCGGCCGCTCGGACTGCGG No data
933060846_933060850 -8 Left 933060846 2:77735002-77735024 CCAGGGCTTGCGGGCCGGCCGGC No data
Right 933060850 2:77735017-77735039 CGGCCGGCCGCTCGGACTGCGGG No data
933060846_933060856 9 Left 933060846 2:77735002-77735024 CCAGGGCTTGCGGGCCGGCCGGC No data
Right 933060856 2:77735034-77735056 TGCGGGGTGCTCAGAGTGCGGGG No data
933060846_933060854 7 Left 933060846 2:77735002-77735024 CCAGGGCTTGCGGGCCGGCCGGC No data
Right 933060854 2:77735032-77735054 ACTGCGGGGTGCTCAGAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933060846 Original CRISPR GCCGGCCGGCCCGCAAGCCC TGG (reversed) Intergenic
No off target data available for this crispr