ID: 933063565

View in Genome Browser
Species Human (GRCh38)
Location 2:77768048-77768070
Sequence TGCCACCATCGATGATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933063565_933063572 8 Left 933063565 2:77768048-77768070 CCTGGGCATCATCGATGGTGGCA No data
Right 933063572 2:77768079-77768101 ACAGGCTCCTGGGCAAAAAAGGG No data
933063565_933063575 23 Left 933063565 2:77768048-77768070 CCTGGGCATCATCGATGGTGGCA No data
Right 933063575 2:77768094-77768116 AAAAAGGGTGTGTCCCCAGGAGG No data
933063565_933063569 -3 Left 933063565 2:77768048-77768070 CCTGGGCATCATCGATGGTGGCA No data
Right 933063569 2:77768068-77768090 GCAGGAGGCAGACAGGCTCCTGG 0: 106
1: 220
2: 246
3: 291
4: 701
933063565_933063574 20 Left 933063565 2:77768048-77768070 CCTGGGCATCATCGATGGTGGCA No data
Right 933063574 2:77768091-77768113 GCAAAAAAGGGTGTGTCCCCAGG No data
933063565_933063568 -10 Left 933063565 2:77768048-77768070 CCTGGGCATCATCGATGGTGGCA No data
Right 933063568 2:77768061-77768083 GATGGTGGCAGGAGGCAGACAGG 0: 41
1: 78
2: 143
3: 252
4: 808
933063565_933063570 -2 Left 933063565 2:77768048-77768070 CCTGGGCATCATCGATGGTGGCA No data
Right 933063570 2:77768069-77768091 CAGGAGGCAGACAGGCTCCTGGG 0: 103
1: 232
2: 274
3: 310
4: 716
933063565_933063576 24 Left 933063565 2:77768048-77768070 CCTGGGCATCATCGATGGTGGCA No data
Right 933063576 2:77768095-77768117 AAAAGGGTGTGTCCCCAGGAGGG No data
933063565_933063571 7 Left 933063565 2:77768048-77768070 CCTGGGCATCATCGATGGTGGCA No data
Right 933063571 2:77768078-77768100 GACAGGCTCCTGGGCAAAAAAGG 0: 5
1: 45
2: 106
3: 210
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933063565 Original CRISPR TGCCACCATCGATGATGCCC AGG (reversed) Intergenic
No off target data available for this crispr