ID: 933064448

View in Genome Browser
Species Human (GRCh38)
Location 2:77776508-77776530
Sequence TATTTAGCTGCCACTTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933064441_933064448 26 Left 933064441 2:77776459-77776481 CCCAGGGTGTGTTCTTCCCCTCT No data
Right 933064448 2:77776508-77776530 TATTTAGCTGCCACTTATAAGGG No data
933064444_933064448 9 Left 933064444 2:77776476-77776498 CCCTCTATGTGTCCATGTGTTCA 0: 10
1: 777
2: 2172
3: 8801
4: 19746
Right 933064448 2:77776508-77776530 TATTTAGCTGCCACTTATAAGGG No data
933064443_933064448 10 Left 933064443 2:77776475-77776497 CCCCTCTATGTGTCCATGTGTTC 0: 607
1: 1749
2: 7383
3: 17723
4: 17818
Right 933064448 2:77776508-77776530 TATTTAGCTGCCACTTATAAGGG No data
933064446_933064448 -3 Left 933064446 2:77776488-77776510 CCATGTGTTCATCATTTAGCTAT No data
Right 933064448 2:77776508-77776530 TATTTAGCTGCCACTTATAAGGG No data
933064440_933064448 27 Left 933064440 2:77776458-77776480 CCCCAGGGTGTGTTCTTCCCCTC No data
Right 933064448 2:77776508-77776530 TATTTAGCTGCCACTTATAAGGG No data
933064442_933064448 25 Left 933064442 2:77776460-77776482 CCAGGGTGTGTTCTTCCCCTCTA No data
Right 933064448 2:77776508-77776530 TATTTAGCTGCCACTTATAAGGG No data
933064445_933064448 8 Left 933064445 2:77776477-77776499 CCTCTATGTGTCCATGTGTTCAT No data
Right 933064448 2:77776508-77776530 TATTTAGCTGCCACTTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933064448 Original CRISPR TATTTAGCTGCCACTTATAA GGG Intergenic
No off target data available for this crispr