ID: 933066809

View in Genome Browser
Species Human (GRCh38)
Location 2:77808138-77808160
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 2, 1: 1, 2: 17, 3: 28, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933066809_933066817 -9 Left 933066809 2:77808138-77808160 CCGGACTTGGGGTACCCACTGGG 0: 2
1: 1
2: 17
3: 28
4: 136
Right 933066817 2:77808152-77808174 CCCACTGGGTGGTGTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933066809 Original CRISPR CCCAGTGGGTACCCCAAGTC CGG (reversed) Intergenic
901192338 1:7420097-7420119 CCCAGTGGGGACCTCCACTCTGG + Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
906124092 1:43415975-43415997 CCCAGTAGGTCCCCTGAGTCTGG - Exonic
906344046 1:45004229-45004251 CTCAGTGAGTTCCCCAAGGCAGG - Exonic
911845611 1:102747577-102747599 CCCAGTGGGGATCCCTAGTGGGG + Intergenic
912930477 1:113954738-113954760 CACAGTGGGTACCCCAAATTAGG - Exonic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
921065961 1:211621997-211622019 CCCAGTGGGGTCCCCGGGTCTGG + Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
924792583 1:247266459-247266481 CCCAGTGGGCACCCCAATTCCGG - Intergenic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1069780131 10:70950184-70950206 CCCACTGGGGAGCCCAAGCCGGG - Intergenic
1073043119 10:100620842-100620864 GCAACAGGGTACCCCAAGTCTGG - Intergenic
1077670388 11:4151902-4151924 CTTAGGGGGTACCCAAAGTCAGG + Intergenic
1077888653 11:6403689-6403711 CCCAGTGGGAACCCCCCGGCCGG - Exonic
1080775598 11:35383463-35383485 GCCAGTGGGGAGCCCAACTCTGG + Intronic
1083764761 11:64836465-64836487 CCCAGCTGGTAGCCCAGGTCAGG - Exonic
1084690076 11:70719988-70720010 CCCAGTGGGTGACCCCAGGCAGG + Intronic
1084916728 11:72434262-72434284 CCCGGTGGCTGCCCCACGTCCGG + Exonic
1086993372 11:93330369-93330391 CCCACTGCCTACCCCAAGGCTGG - Intronic
1088709898 11:112498835-112498857 TCCAGTGGCCACCCCAAGTGAGG - Intergenic
1090842799 11:130507496-130507518 CCCAGTGGGTACTCTATGTGGGG - Intergenic
1091624877 12:2114168-2114190 CCCAGGAGAGACCCCAAGTCAGG - Intronic
1091963613 12:4720033-4720055 CCCAGCGGATACCCCGAGTCCGG + Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1094471332 12:30804315-30804337 CCCAGTGGGTACTCTATGTGGGG + Intergenic
1095095366 12:38145008-38145030 GCCAGTGGGTACCCCGAGTCCGG - Intergenic
1096556269 12:52406030-52406052 CCCAGTCGGTACCCGAAGCCAGG + Exonic
1096572848 12:52533692-52533714 CCCAGTTGGTGTCCCAAGTGTGG + Intergenic
1099621304 12:85005624-85005646 CCCAGTGGGTACCCTATGTGTGG - Intergenic
1101333064 12:103772715-103772737 CCCAGAGGGTTTCCCAAGTTGGG + Exonic
1103946504 12:124530264-124530286 ATCAGTGGGTACCTCTAGTCGGG + Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1109106095 13:58252881-58252903 CCCTGGGTGTACCCCAAGGCTGG - Intergenic
1111195373 13:84869689-84869711 CCCAGCAGGTATCCCAAGTCTGG - Intergenic
1111196260 13:84877275-84877297 CACAGTGGGTACCTTGAGTCTGG - Intergenic
1115889554 14:38011573-38011595 CCCGGCAGGTTCCCCAAGTCCGG - Intronic
1116415505 14:44672647-44672669 CCCAGTGGGGACTCCATGTTGGG + Intergenic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1117234032 14:53752610-53752632 CCCAGTGGGTACCACCAGCATGG - Intergenic
1117349404 14:54866752-54866774 CACAGTTATTACCCCAAGTCAGG + Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG + Intergenic
1126825050 15:52540301-52540323 CCCAGTGGGGACCCAGAGTGGGG + Intergenic
1129465832 15:75723746-75723768 CCCAGTGGGTGCCCTAAGGTTGG - Intergenic
1130562410 15:84968934-84968956 CCCAGAGGGTGCCCCAGCTCAGG - Intergenic
1132852808 16:2032569-2032591 CCCAGGGGGCACCCAAAGTTGGG - Intronic
1133047397 16:3096388-3096410 CCCAGTTGGCACCCCAGGTAGGG + Intronic
1134123056 16:11598237-11598259 CTCAGTGGGTGCCCCAAGAGAGG - Intronic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1137604787 16:49780270-49780292 CCCAATGGGGGCCCCAAGGCTGG + Intronic
1137630565 16:49940836-49940858 CACAGTGGGTTCCCCAGGTGTGG - Intergenic
1138564639 16:57824239-57824261 CTCAGTGGCTCCCCCAAGGCAGG - Intronic
1138594461 16:58022459-58022481 CCCAGAGGGTAGACCTAGTCTGG - Intergenic
1139289412 16:65844016-65844038 CCCAGTGGGTGCCCCTGGGCTGG + Intergenic
1141509203 16:84501677-84501699 CCCAGTAGGAACCCCAGGGCTGG + Intronic
1141645131 16:85363408-85363430 CCCAGTGGTTCCCCAAAGCCTGG - Intergenic
1143986124 17:10915950-10915972 CCAAGTGGATACCCCAGGTAAGG + Intergenic
1144958087 17:19029688-19029710 CCCAGAGGGTAGCCCCAGTCTGG - Intronic
1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG + Intronic
1148746485 17:49921029-49921051 CCAAGCGGGCACCCCAGGTCCGG + Intergenic
1149386868 17:56151033-56151055 CCTAGTGGGCTCCCCATGTCAGG - Intronic
1152578973 17:81157694-81157716 CCCAGGGCCTACCCCAAGGCTGG + Intronic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1159960255 18:74550101-74550123 CCCAGTGGGGACCCTATGTGGGG - Intronic
1159996604 18:74970812-74970834 CCCAGTGGGGACTCCATGTGGGG + Intronic
1161031731 19:2060881-2060903 CCCAGTGAGGCCCCCATGTCGGG + Intergenic
1162009144 19:7801070-7801092 ACCCGTGGGTACCTGAAGTCCGG + Intergenic
1162079169 19:8208734-8208756 CACCCTGGGTACCCCGAGTCTGG - Intronic
1163417423 19:17195142-17195164 CCCAGTGGGAGCCCCAGGCCTGG + Exonic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1167823067 19:51947666-51947688 CACAGTGGAAACCCGAAGTCTGG + Intronic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933187892 2:79299125-79299147 CCAAGTGGATACAGCAAGTCAGG + Intronic
933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG + Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933697208 2:85228589-85228611 CTCCTTGGGAACCCCAAGTCAGG - Intronic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
939506882 2:143056866-143056888 CCCAGTGGGAACTCCATGTGGGG + Intergenic
940868291 2:158838342-158838364 CCTCGTTGGTACCCCAAGTGTGG - Intronic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
943960439 2:194256185-194256207 CCCGGCCGGTACCCCGAGTCCGG + Intergenic
946035315 2:216737379-216737401 CCCAGGGCTTATCCCAAGTCTGG - Intergenic
947859430 2:233348311-233348333 CCCGGTGGGTACCTCAGGGCAGG - Intergenic
1169083029 20:2809078-2809100 CCTAGCGGTTACCCCGAGTCCGG + Intergenic
1169206395 20:3742522-3742544 CCCAGTGGGGAGCCCCAGACTGG - Intronic
1169714654 20:8601492-8601514 CACAATGGGTATCACAAGTCAGG - Intronic
1171388394 20:24785795-24785817 GTGAGTGGGTACCTCAAGTCTGG - Intergenic
1174420657 20:50397030-50397052 CGCAGTGGCAACCCCAAGTAGGG - Intergenic
1176139139 20:63537528-63537550 CCCAGTGGGTTCCCATAGTGCGG - Intergenic
1180160846 21:45998062-45998084 GCCAGTGGGTATCCCAGGCCAGG + Intronic
1183438201 22:37807633-37807655 TCCAGAGGGTACCCCATTTCCGG + Intergenic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
1185008621 22:48300304-48300326 CCCAGTGGCTGCCCCAGGCCTGG - Intergenic
1185211203 22:49571543-49571565 TCCACTGGGGACCCCAAGGCAGG + Intronic
950146442 3:10653442-10653464 CCAAGTGGGTCCCTCAACTCAGG - Intronic
950742752 3:15063364-15063386 CCCAGCAGGTACCCAAAGACTGG + Intronic
951994035 3:28706901-28706923 ACCAGTGGATTCCCCAAATCTGG - Intergenic
951999786 3:28772315-28772337 CCCACTGGGTACTCCTAGTCAGG - Intergenic
953568371 3:44052146-44052168 GCCAGTGTATTCCCCAAGTCTGG + Intergenic
954300999 3:49700736-49700758 TCCAGAGGGCACCCCATGTCTGG - Intronic
954689148 3:52386604-52386626 CCCAGTGGGCACCCCTCGGCAGG - Intronic
955115731 3:55998893-55998915 GGCACTGGGTACCCCAAGTGTGG + Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
955871415 3:63442371-63442393 CCGAGTGGGGACCCAAAGTAGGG + Intronic
957694551 3:83618435-83618457 CCCAGCGGGTACTCCGAGTCCGG + Intergenic
957738634 3:84233868-84233890 CCCAGTGGGAACCCCGTGTGGGG + Intergenic
960396137 3:117139679-117139701 CCCAGTGGGTTTCCCAGGTTTGG - Intergenic
961712024 3:128835127-128835149 CCCACAGGGTACCCGAGGTCGGG - Intergenic
962412109 3:135150346-135150368 CCCAGTGGGTCCACAAAGACAGG - Intronic
963317244 3:143772703-143772725 CTGAGTGGTTGCCCCAAGTCCGG + Intronic
966246535 3:177814187-177814209 CCCAGTGGGTGCTGCAAGTAAGG + Intergenic
969201290 4:5608308-5608330 CCCACTGTGGAGCCCAAGTCTGG - Intronic
971258693 4:25036347-25036369 CTCAGTGGGTGTCACAAGTCTGG + Intergenic
974013413 4:56627410-56627432 CCCAGTGGGTAACAGAAGGCTGG - Intergenic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
978255989 4:106693646-106693668 CCCAGTGGGGACTCCATGTGGGG - Intergenic
978826625 4:113032318-113032340 CACAGTTTGTGCCCCAAGTCTGG - Intronic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
981336454 4:143573867-143573889 CCCAGTTGGTATCCCAAGGGTGG + Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
984131245 4:175878289-175878311 CCCAGTGGAGACTCCATGTCGGG + Intronic
984816165 4:183838723-183838745 CACAATGGGTGCCCCAAGTGGGG - Intergenic
985635138 5:1032158-1032180 CCCAATGGGGACCCCAAGGAGGG + Exonic
987252298 5:16112141-16112163 CCCAGTGGGGACTCCATGTGGGG - Intronic
987585033 5:19843572-19843594 CCCAGTGGGAACTCTATGTCGGG - Intronic
988842396 5:35095769-35095791 CCCAATGGGTACCTCAAAACAGG - Intronic
991186590 5:63815705-63815727 CCCACTGGGAACTCCATGTCAGG - Intergenic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
995701396 5:114939372-114939394 CCCAGTGGGGACTCCATGTCGGG - Intergenic
999243456 5:150140585-150140607 CAGAGTGAGGACCCCAAGTCCGG + Intronic
1004319836 6:14623787-14623809 ACCAGTGGGTACACCTAGTATGG + Intergenic
1004454927 6:15783614-15783636 CCCAGTGTCTACCACAAGACTGG + Intergenic
1005113669 6:22313578-22313600 CCCAGTGGGGACTCCATGTGGGG + Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1007021521 6:38526463-38526485 CCCAGTGGGGACTCCATGTAGGG - Intronic
1008236485 6:49057686-49057708 CCCAGTGGGTACCCAGTGTGGGG + Intergenic
1010536636 6:77038812-77038834 CCCAGTGGGGACTCCATGTAGGG - Intergenic
1011820201 6:91244577-91244599 CCCTCTGGGAACCCCCAGTCTGG - Intergenic
1013338696 6:109191883-109191905 CCCAGTGGGGACCCCATATAGGG - Intergenic
1015939229 6:138431918-138431940 CCCAGTGGGCACCCCACTGCTGG + Exonic
1020113617 7:5462366-5462388 ACCAGTGGGTACCCACAGTGGGG - Intronic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1023519011 7:41032204-41032226 AGCAGTGTGTACCCCAAGTCTGG - Intergenic
1024137330 7:46423638-46423660 CCCAGTGGGTTCCCCACCTCTGG + Intergenic
1025250317 7:57347455-57347477 CACAGTGGCAACCCCAAGTAGGG + Intergenic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1033669104 7:143472697-143472719 CCCAGCGGGTACTCCGAGTCCGG - Intergenic
1034258126 7:149735551-149735573 CCCAGTGTGTCCCTCAAGTCAGG + Intergenic
1034367168 7:150561096-150561118 ACCTGCGGGTACCCAAAGTCTGG + Intergenic
1035844737 8:2850887-2850909 CCCAGTGGAAACCCCATTTCCGG + Intergenic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1038436785 8:27541817-27541839 CCCTGGTGGTACCCCAAGGCAGG + Intronic
1039109168 8:34022734-34022756 ACCTGTGGCCACCCCAAGTCTGG - Intergenic
1040138433 8:43882515-43882537 CCCCGTGGGTGCCCCTAGTCTGG + Intergenic
1040725689 8:50379126-50379148 GCTAGTTGGTGCCCCAAGTCTGG + Intronic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG + Intergenic
1043295335 8:78654629-78654651 CCCAGTGTGTACCCCAAGTCCGG - Intergenic
1046735192 8:117768936-117768958 CCCAGTGGGGACACCATGTGGGG - Intergenic
1048852209 8:138656080-138656102 CCCAGTGGATGTCCCAAGCCTGG + Intronic
1050109510 9:2200230-2200252 CCCAGTGGGGACTCTAAGTGGGG + Intergenic
1052488145 9:29128672-29128694 CCCAGTGGGTAACCCAATGAAGG - Intergenic
1053423802 9:37997972-37997994 CACAGTGGGTACCACAAGCCAGG - Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1062615044 9:137392524-137392546 CCCAGTGGGCTCCCCTACTCAGG - Intronic
1188715759 X:33457247-33457269 CCCAGTGGGGACTCTAAGTGTGG + Intergenic
1194841700 X:98752045-98752067 CCCAGTGGGGACTCCATGTGGGG + Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1201776467 Y:17671239-17671261 CCCAGTGGGTACACTGACTCTGG + Intergenic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1201825089 Y:18234753-18234775 CCCAGTGGGTACACTGACTCTGG - Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG + Intronic
1202326403 Y:23695294-23695316 CCCAGTGTGTACCCCGAATCTGG - Intergenic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic