ID: 933077736

View in Genome Browser
Species Human (GRCh38)
Location 2:77950861-77950883
Sequence TCCATGGTTTAAAGTAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933077736_933077739 23 Left 933077736 2:77950861-77950883 CCTCTTCTACTTTAAACCATGGA No data
Right 933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933077736 Original CRISPR TCCATGGTTTAAAGTAGAAG AGG (reversed) Intergenic
No off target data available for this crispr