ID: 933077737

View in Genome Browser
Species Human (GRCh38)
Location 2:77950877-77950899
Sequence TTCATTAGGTTCTTTTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933077737_933077739 7 Left 933077737 2:77950877-77950899 CCATGGAAAAAGAACCTAATGAA No data
Right 933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG No data
933077737_933077742 15 Left 933077737 2:77950877-77950899 CCATGGAAAAAGAACCTAATGAA No data
Right 933077742 2:77950915-77950937 CTAGAAGAGTGAAGGCCTCCTGG 0: 27
1: 53
2: 45
3: 55
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933077737 Original CRISPR TTCATTAGGTTCTTTTTCCA TGG (reversed) Intergenic
No off target data available for this crispr