ID: 933077738

View in Genome Browser
Species Human (GRCh38)
Location 2:77950891-77950913
Sequence AGGGCACAGCATCATTCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933077738_933077746 29 Left 933077738 2:77950891-77950913 CCTAATGAATGATGCTGTGCCCT No data
Right 933077746 2:77950943-77950965 TTCTCTTTAACCCATAATGTGGG No data
933077738_933077742 1 Left 933077738 2:77950891-77950913 CCTAATGAATGATGCTGTGCCCT No data
Right 933077742 2:77950915-77950937 CTAGAAGAGTGAAGGCCTCCTGG 0: 27
1: 53
2: 45
3: 55
4: 162
933077738_933077745 28 Left 933077738 2:77950891-77950913 CCTAATGAATGATGCTGTGCCCT No data
Right 933077745 2:77950942-77950964 GTTCTCTTTAACCCATAATGTGG No data
933077738_933077739 -7 Left 933077738 2:77950891-77950913 CCTAATGAATGATGCTGTGCCCT No data
Right 933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933077738 Original CRISPR AGGGCACAGCATCATTCATT AGG (reversed) Intergenic
No off target data available for this crispr